359 resultados para An. cruzii
Resumo:
Motivated by the unconventional properties and rich phase diagram of NaxCoO2 we consider the electronic and magnetic properties of a two-dimensional Hubbard model on an isotropic triangular lattice doped with electrons away from half-filling. Dynamical mean-field theory (DMFT) calculations predict that for negative intersite hopping amplitudes (t < 0) and an on-site Coulomb repulsion, U, comparable to the bandwidth, the system displays properties typical of a weakly correlated metal. In contrast, for t > 0 a large enhancement of the effective mass, itinerant ferromagnetism, and a metallic phase with a Curie-Weiss magnetic susceptibility are found in a broad electron doping range. The different behavior encountered is a consequence of the larger noninteracting density of states (DOS) at the Fermi level for t > 0 than for t < 0, which effectively enhances the mass and the scattering amplitude of the quasiparticles. The shape of the DOS is crucial for the occurrence of ferromagnetism as for t > 0 the energy cost of polarizing the system is much smaller than for t < 0. Our observation of Nagaoka ferromagnetism is consistent with the A-type antiferromagnetism (i.e., ferromagnetic layers stacked antiferromagnetically) observed in neutron scattering experiments on NaxCoO2. The transport and magnetic properties measured in NaxCoO2 are consistent with DMFT predictions of a metal close to the Mott insulator and we discuss the role of Na ordering in driving the system towards the Mott transition. We propose that the Curie-Weiss metal phase observed in NaxCoO2 is a consequence of the crossover from a bad metal with incoherent quasiparticles at temperatures T > T-* and Fermi liquid behavior with enhanced parameters below T-*, where T-* is a low energy coherence scale induced by strong local Coulomb electron correlations. Our analysis also shows that the one band Hubbard model on a triangular lattice is not enough to describe the unusual properties of NaxCoO2 and is used to identify the simplest relevant model that captures the essential physics in NaxCoO2. We propose a model which allows for the Na ordering phenomena observed in the system which, we propose, drives the system close to the Mott insulating phase even at large dopings.
Resumo:
This paper examines upper-body movement kinematics in individuals with high-functioning autism (HFA) and Asperger's disorder (AD). In general, the results indicate that HFA is more consistently associated with impaired motoric preparation/initiation than AD. The data further suggest that this quantitative difference in motor impairment is not necessarily underpinned by greater executive dysfunction vulnerability in autism relative to AD. Quantitative motoric dissociation between autism and AD may have down-stream effects on later stages of movement resulting in qualitative differences between these disorder groups, e.g. motor clumsiness in AD versus abnormal posturing in autism. It will be important for future research to map the developmental trajectory of motor abnormalities in these disorder groups.
Resumo:
Vertical direct chill (VDC) casting of aluminium alloys is a mature process that has evolved over many decades through gradual change to both equipment design and casting practice. Today, air-pressurised, continuous lubrication, hot top mould systems with advanced station automation are selected as the process of choice for producing extrusion billet. Specific sets of operating parameters are employed on these stations for each alloy and size combination to produce optimal billet quality. The designs and parameters are largely derived from past experience and accumulated know-how. Recent experimental work at the University of Queensland has concentrated on understanding the way in which the surface properties of liquid aluminium alloys, e.g., surface tension, wetting angle and oxide skin strength, influence the size and shape of the naturally-stab le meniscus for a given alloy, temperature and atmosphere. The wide range of alloy-and condition-dependent values measured has led to the consideration of how these properties impact the stability of the enforced molten metal meniscus within the hot top mould cavity. The actual shape and position of the enforced meniscus is controlled by parameters such as the upstream conduction distance (UCD) from sub-mould cooling and the molten metal head. The degree of deviation of this actual meniscus from the predicted stable meniscus is considered to be a key driver in surface defect formation. This paper reports on liquid alloy property results and proposes how this knowledge might be used to better design VDC mould systems and casting practices.
Resumo:
Conditions which influence the viability, integrity, and extraction efficiency of the isolated perfused rat liver were examined to establish optimal conditions for subsequent work in reperfusion injury studies including the choice of buffer, use of oncotic agents, hematocrit, perfusion flow rate, and pressure. Rat livers were perfused with MOPS-buffered Ringer solution with or without erythrocytes. Perfusates were collected and analyzed for blood gases, electrolytes, enzymes, radioactivity in MID studies, and lignocaine in extraction studies. Liver tissue was sampled for histological examinations, and wet:dry weight of the liver was also determined. MOPS-buffered Ringer solution was found to be superior to Krebs bicarbonate buffer, in terms of pH control and buffering capacity, especially during any prolonged period of liver perfusion. A pH of 7.2 is chosen for perfusion since this is the physiological pH of the portal blood. The presence of albumin was important as an oncotic agent, particularly when erythrocytes were used in the perfusate. Perfusion pressure, resistance, and vascular volume are how-dependent and the inclusion of erythrocytes in the perfusate substantially altered the flow characteristics for perfusion pressure and resistance but not vascular volume. Lignocaine extraction was relatively flow-independent. Perfusion injury as defined by enzyme release and tissue fine structure was closely related to the supply of O-2. The optimal conditions for liver perfusion depend upon an adequate supply of oxygen. This can be achieved by using either erythrocyte-free perfusate at a how rate greater than 6 ml/min/g liver or a 20% erythrocyte-containing perfusate at 2 ml/min/g. (C) 1996 Academic Press, Inc.
Resumo:
To understand the dynamic mechanisms of the mechanical milling process in a vibratory mill, it is necessary to determine the characteristics of the impact forces associated with the collision events. However, it is difficult to directly measure the impact force in an operating mill. This paper describes an inverse technique for the prediction of impact forces from acceleration measurements on a vibratory ball mill. The characteristics of the vibratory mill have been investigated by the modal testing technique, and its system modes have been identified. In the modelling of the system vibration response to the impact forces, two modal equations have been used to describe the modal responses. The superposition of the modal responses gives rise to the total response of the system. A method based on an optimisation approach has been developed to predict the impact forces by minimising the difference between the measured acceleration of the vibratory ball mill and the predicted acceleration from the solution of the modal equations. The predicted and measured impact forces are in good agreement. Copyright (C) 1996 Elsevier Science Ltd.
Resumo:
The technical reliability (i.e., interinstrument and interoperator reliability) of three SEAC-swept frequency bioimpedance monitors was assessed for both errors of measurement and associated analyses. In addition, intraoperator and intrainstrument variability was evaluated for repeat measures over a 4-hour period. The measured impedance values from a range of resistance-capacitance circuits were accurate to within 3% of theoretical values over a range of 50-800 ohms. Similarly, phase was measured over the range 1 degrees-19 degrees with a maximum deviation of 1.3 degrees from the theoretical value. The extrapolated impedance at zero frequency was equally well determined (+/-3%). However, the accuracy of the extrapolated value at infinite frequency was decreased, particularly at impedances below 50 ohms (approaching the lower limit of the measurement range of the instrument). The interinstrument/operator variation for whole body measurements were recorded on human volunteers with biases of less than +/-1% for measured impedance values and less than 3% for phase. The variation in the extrapolated values of impedance at zero and infinite frequencies included variations due to operator choice of the analysis parameters but was still less than +/-0.5%. (C) 1997 Wiley-Liss, Inc.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Biologic valve re-replacement was examined in a series of 1343 patients who underwent aortic valve replacement at The Prince Charles Hospital, Brisbane, with a cryopreserved or 4 degrees C stored allograft valve or a xenograft valve, A parametric model approach was used to simultaneously model the competing risks of death without re-replacement and re-replacement before death, One hundred eleven patients underwent a first re-replacement for a variety of reasons (69 patients with xenograft valves, 28 patients with 4 degrees C stored allograft valves, and 14 patients with cryopreserved allograft valves), By multivariable analysis younger age at operation was associated with xenograft, 4 degrees C stored allograft, and cryopreserved allograft valve re-replacement, However, this effect was examined in the context of longer survival of younger patients, which increases their exposure to the risk of re-replacement as compared with that in older patients whose decreased survival reduced their probability of requiring valve re-replacement, In patients older than 60 years at the time of aortic valve replacement, the probability of re-replacement (for any reason) before death was similar for xenografts and cryopreserved allograft valves but higher for 4 degrees C stored valves, However, in patients younger than 60 years, the probability of re-replacement at any time during the remainder of the life of the patient was lower with the cryopreserved allograft valve compared with the xenograft valve and 4 degrees C stored allografts.
Resumo:
Increased Kt concentration in seawater induces metamorphosis in the ascidian Herdmania momus. Larvae cultivated at 24 degrees C exhibit highest rates of metamorphosis when treated with 40 mM KCl-elevated seawater at 21 degrees C. At 24 degrees C, H. momus larvae develop competence to respond to KCl-seawater and initiate metamorphosis approximately 3 h after hatching. Larval trunks and tails separated from the anterior papillae region, but maintained in a common tunic at a distance of greater than 60 mu m, do not undergo metamorphosis when treated with KCl-seawater; normal muscle degradation does not occur in separated tails while ampullae develop from papillae-containing anterior fragments. Normal programmed degradation of myofibrils occurs when posterior fragments are fused to papillae-containing anterior fragments. These data indicate that H. momus settlement and metamorphosis only occurs when larvae have attained competence, and suggest that an anterior signalling centre is stimulated to release a factor that induces metamorphosis.
Resumo:
The purpose of this study was to investigate the effects of a specific cognitive race plan on 100 m sprint performance, Twelve elite sprinters (11 male and 1 female) performed 100 m time trials under normal (control) conditions and then under experimental conditions (use of race cues). In the experimental condition, participants were asked to think about specific thought content in each of three segments of the 100 m. A multiple baseline design was employed. A mean improvement of 0.26 s was found. Eleven of the 12 participants showed improvement using the specific cognitive race plan (p < .005). Participants also produced more consistent sprint performances when using the cues (p < .01). Subjective evaluations made by the participants unanimously supported the use of the race plan for optimizing sprint performance. Environmental conditions, effort, and practice effects were considered as possible influences on the results.
Resumo:
This study investigated the effect of two anti-pronation taping techniques on vertical navicular height, an indicator of foot pronation, after its application and 20 min of exercise. The taping techniques were: the low dye (LD) and low dye with the addition of calcaneal slings and reverse sixes (LDCR). A repeated measures study was used. It found that LDCR was superior to LD and control immediately after application and exercise. LD was better than control immediately after application but not after exercise. These findings provide practical directions to clinicians regularly using anti-pronation taping techniques.