214 resultados para human interactions


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Colonius suggests that, in using standard set theory as the language in which to express our computational-level theory of human memory, we would need to violate the axiom of foundation in order to express meaningful memory bindings in which a context is identical to an item in the list. We circumvent Colonius's objection by allowing that a list item may serve as a label for a context without being identical to that context. This debate serves to highlight the value of specifying memory operations in set theoretic notation, as it would have been difficult if not impossible to formulate such an objection at the algorithmic level.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

1 Chronic treatment of patients with beta-blockers causes atrial inotropic hyperresponsiveness through beta(2)-adrenoceptors, 5-HT4 receptors and H-2-receptors but apparently not through beta(1)-adrenoceptors despite data claiming an increased beta(1)-adrenoceptor density from homogenate binding studies. We have addressed the question of beta(1)-adrenoceptor sensitivity by determining the inotropic potency and intrinsic activity of the beta(1)-adrenoceptor selective partial agonist (-)-RO363 and by carrying out both homogenate binding and quantitative beta-adrenoceptor autoradiography in atria obtained from patients treated or not treated with beta-blockers. In the course of the experiments it became apparent that (-)-RO363 also may cause agonistic effects through the third atrial beta-adrenoceptor. To assess whether (-)-RO363 also caused agonistic effects through beta(3)-adrenoceptors we studied its relaxant effects in rat colon and guinea-pig ileum, as well as receptor binding and adenylyl cyclase stimulation of chinese hamster ovary (CHO) cells expressing human beta(3)-adrenoceptors. 2 beta-Adrenoceptors were labelled with (-)-[I-125]-cyanopindolol. The density of both beta(1)- and beta(2)-adrenoceptors was unchanged in the 2 groups, as assessed with both quantitative receptor autoradiography and homogenate binding. The affinities of (-)-RO363 for beta(1)-adrenoceptors (pK(i) = 8.0-7.7) and beta(2)-adrenoceptors (pK(i) = 6.1-5.8) were not significantly different in the two groups. 3 (-)-RO363 increased atrial force with a pEC(50) of 8.2 (beta-blocker treated) and 8.0 (non-beta-blocker treated) and intrinsic activity with respect to (-)-isoprenaline of 0.80 (beta-blocker treated) and 0.54 (non-beta-blocker treated) (P<0.001) and with respect to Ca2+ (7 mM) of 0.65 (beta-blocker treated) and 0.45 (non-beta-blocker treated) (P<0.01). The effects of (-)-RO363 were resistant to antagonism by the beta(2)-adrenoceptor antagonist, ICI 118,551 (50 nM). The effects of 0.3-10 nM (-)-RO363 were antagonized by 3-10 nM of the beta(1)-adrenoceptor selective antagonist CGP 20712A. The effects of 20-1000 nM (-)-RO363 were partially resistant to antagonism by 30-300 nM CGP 20712A. 4 (-)-RO363 relaxed the rat colon, partially precontracted by 30 mM KCl, with an intrinsic activity of 0.97 compared to (-)-isoprenaline. The concentration-effect curve to (-)-RO363 revealed 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.5 and fraction 0.66, the other resistant to (-)-propranolol (200 nM) with pEC(50)=5.6 and fraction 0.34 of maximal relaxation. 5 (-)-RO363 relaxed the longitudinal muscle of guinea-pig ileum, precontracted by 0.5 mu M histamine, with intrinsic activity of 1.0 compared to (-)-isoprenaline and through 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.7 and fraction 0.67, the other resistant to (-)-propranolol with pEC(50)=4.9 and fraction 0.33 of maximal relaxation. 6 (-)-RO363 stimulated the adenylyl cyclase of CHO cells expressing human beta(3)-adrenoceptors with pEC(50)=5.5 and intrinsic activity 0.74 with respect to (-)-isoprenaline (pEC(50)=5.9). (-)-RO363 competed for binding with [I-125]cyanopindolol at human beta(3)-adrenoceptors transfected into CHO cells with pK(i)=4.5. (-)-Isoprenaline (pk(i)=5.2) and (-)-CGP 12177A (pK(i)=6.1) also competed for binding at human beta(2)-adrenoceptors. 7 We conclude that under conditions used in this study, (-)-RO363 is a potent partial agonist for human beta(1)- and beta(3)-adrenoceptors and appears also to activate the third human atrial beta-adrenoceptor. (-)-RO363 relaxes mammalian gut through both beta(1)- and beta(3)-adrenoceptors. (-)-RO363, used as a beta(1)-adrenoceptor selective tool, confirms previous findings with (-)-noradrenaline that beta(1)-adrenoceptor mediated atrial effects are only slightly enhanced by chronic treatment of patients with beta-blockers. Chronic treatment with beta(1)-adrenoceptor-selective blockers does not significantly increase the density of human atrial beta(1)- and beta(2)-adrenoceptors.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).