Biological activity and metabolic clearance of recombinant human follicle stimulating hormone produced in Sp2/0 myeloma cells

Human follicle stimulating hormone is a pituitary glycoprotein that is essential for the maintenance of ovarian follicle development and testicular spermatogenesis. Like other members of the glycoprotein hormone family, it contains a common a subunit and a hormone specific beta subunit. Each subunit contains two glycosylation sites. The specific structures of the oligosaccharides of human follicle stimulating hormone have been shown to influence both the in vitro and in vivo bioactivity. Since the carbohydrate structure of a protein reflects the glycosylation apparatus of the host cells in which the protein is expressed, we examined the isoform profiles, in vitro bioactivity and metabolic clearance of a preparation of purified recombinant human follicle stimulating hormone derived from a stable, transfected Sp2/0 myeloma cell line, and pituitary human follicle stimulating hormone. Isoelectric focussing and chromatofocussing studies of human follicle stimulating hormone preparations both showed a more basic isoform profile for the recombinant human follicle stimulating hormone compared to that of pituitary human follicle stimulating hormone. The recombinant human follicle stimulating hormone had a significantly higher radioreceptor activity compared to that of pituitary human follicle stimulating hormone, consistent with a greater in vitro potency. Pharmacokinetic studies in rats indicated a similar terminal half life (124 min) to that of the pituitary human follicle stimulating hormone (119 min). Preliminary carbohydrate analysis showed recombinant human follicle stimulating hormone to contain high mannose and/or hybrid type, in addition to complex type carbohydrate chains, terminating with both alpha 2,3 and alpha 2,6 linked sialic acids. These results demonstrate that recombinant human follicle stimulating hormone made in the Sp2/0 myeloma cells is sialylated, has a more basic isoform profile, and has a greater in vitro biological potency compared to those of the pituitary human follicle stimulating hormone.

Processing of mutated human proinsulin to mature insulin in the non-endocrine cell line, CHO

Heterologous genes encoding proproteins, including proinsulin, generally produce mature protein when expressed in endocrine cells while unprocessed or partially processed protein is produced in non-endocrine cells. Proproteins, which are normally processed in the regulated pathway restricted to endocrine cells, do not always contain the recognition sequence for cleavage by furin, the endoprotease specific to the constitutive pathway, the principal protein processing pathway in non-endocrine cells. Human proinsulin consists of B-Chain-C-peptide-A-Chain and cleavage at the B/C and C/A junctions is required for processing. The B/C, but not the C/A junction, is recognised and cleaved in the constitutive pathway. We expressed a human proinsulin and a mutated proinsulin gene with an engineered furin recognition sequence at the C/A junction and compared the processing efficiency of the mutant and native proinsulin in Chinese Hamster Ovary cells. The processing efficiency of the mutant proinsulin was 56% relative to 0.7% for native proinsulin. However, despite similar levels of mRNA being expressed in both cell lines, the absolute levels of immunoreactive insulin, normalized against mRNA levels, were 18-fold lower in the mutant proinsulin-expressing cells. As a result, there was only a marginal increase in absolute levels of insulin produced by these cells. This unexpected finding may result from preferential degradation of insulin in non-endocrine cells which lack the protection offered by the secretory granules found in endocrine cells.

Mathematical constraints on a theory of human memory - Response

Colonius suggests that, in using standard set theory as the language in which to express our computational-level theory of human memory, we would need to violate the axiom of foundation in order to express meaningful memory bindings in which a context is identical to an item in the list. We circumvent Colonius's objection by allowing that a list item may serve as a label for a context without being identical to that context. This debate serves to highlight the value of specifying memory operations in set theoretic notation, as it would have been difficult if not impossible to formulate such an objection at the algorithmic level.

Insertion/deletion polymorphism of the angiotensin converting enzyme gene and loss of the insertion allele in aldosterone-producing adenoma

The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.

Identification and characterization of a G protein-coupled receptor homolog encoded by murine cytomegalovirus

This report describes the identification of a murine cytomegalovirus (MCMV) G protein-coupled receptor (GCR) homolog. This open reading frame (M33) is most closely related to, and collinear with, human cytomegalovirus UL33, and homologs are also present in human herpesvirus 6 and 7 (U12 for both viruses). Conserved counterparts in the sequenced alpha- or gammaherpesviruses have not been identified to date, suggesting that these genes encode proteins which are important for the biological characteristics of betaherpesviruses. We have detected transcripts for both UL33 and M33 as early as 3 or 4 h postinfection, and these reappear at late times. In addition, we have identified N-terminal splicing for both the UL33 and M33 RNA transcripts. For both open reading frames, splicing results in the introduction of amino acids which are highly conserved among known GCRs. To characterise the function of the M33 in the natural host, two independent MCMV recombinant viruses were prepared, each of which possesses an M33 open reading frame which has been disrupted with the beta-galactosidase gene. While the recombinant M33 null viruses showed no phenotypic differences in replication from wild-type MCMV in primary mouse embryo fibroblasts in vitro, they showed severely restricted growth in the salivary glands of infected mice. These data suggest that M33 plays an important role in vivo, in particular in the dissemination to or replication in the salivary gland, and provide the first evidence for the function of a viral GCR homolog in vivo.

Effects of (-)-RO363 at human atrial beta-adrenoceptor subtypes, the human cloned beta(3)-adrenoceptor and rodent intestinal beta(3)-adrenoceptors

1 Chronic treatment of patients with beta-blockers causes atrial inotropic hyperresponsiveness through beta(2)-adrenoceptors, 5-HT4 receptors and H-2-receptors but apparently not through beta(1)-adrenoceptors despite data claiming an increased beta(1)-adrenoceptor density from homogenate binding studies. We have addressed the question of beta(1)-adrenoceptor sensitivity by determining the inotropic potency and intrinsic activity of the beta(1)-adrenoceptor selective partial agonist (-)-RO363 and by carrying out both homogenate binding and quantitative beta-adrenoceptor autoradiography in atria obtained from patients treated or not treated with beta-blockers. In the course of the experiments it became apparent that (-)-RO363 also may cause agonistic effects through the third atrial beta-adrenoceptor. To assess whether (-)-RO363 also caused agonistic effects through beta(3)-adrenoceptors we studied its relaxant effects in rat colon and guinea-pig ileum, as well as receptor binding and adenylyl cyclase stimulation of chinese hamster ovary (CHO) cells expressing human beta(3)-adrenoceptors. 2 beta-Adrenoceptors were labelled with (-)-[I-125]-cyanopindolol. The density of both beta(1)- and beta(2)-adrenoceptors was unchanged in the 2 groups, as assessed with both quantitative receptor autoradiography and homogenate binding. The affinities of (-)-RO363 for beta(1)-adrenoceptors (pK(i) = 8.0-7.7) and beta(2)-adrenoceptors (pK(i) = 6.1-5.8) were not significantly different in the two groups. 3 (-)-RO363 increased atrial force with a pEC(50) of 8.2 (beta-blocker treated) and 8.0 (non-beta-blocker treated) and intrinsic activity with respect to (-)-isoprenaline of 0.80 (beta-blocker treated) and 0.54 (non-beta-blocker treated) (P<0.001) and with respect to Ca2+ (7 mM) of 0.65 (beta-blocker treated) and 0.45 (non-beta-blocker treated) (P<0.01). The effects of (-)-RO363 were resistant to antagonism by the beta(2)-adrenoceptor antagonist, ICI 118,551 (50 nM). The effects of 0.3-10 nM (-)-RO363 were antagonized by 3-10 nM of the beta(1)-adrenoceptor selective antagonist CGP 20712A. The effects of 20-1000 nM (-)-RO363 were partially resistant to antagonism by 30-300 nM CGP 20712A. 4 (-)-RO363 relaxed the rat colon, partially precontracted by 30 mM KCl, with an intrinsic activity of 0.97 compared to (-)-isoprenaline. The concentration-effect curve to (-)-RO363 revealed 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.5 and fraction 0.66, the other resistant to (-)-propranolol (200 nM) with pEC(50)=5.6 and fraction 0.34 of maximal relaxation. 5 (-)-RO363 relaxed the longitudinal muscle of guinea-pig ileum, precontracted by 0.5 mu M histamine, with intrinsic activity of 1.0 compared to (-)-isoprenaline and through 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.7 and fraction 0.67, the other resistant to (-)-propranolol with pEC(50)=4.9 and fraction 0.33 of maximal relaxation. 6 (-)-RO363 stimulated the adenylyl cyclase of CHO cells expressing human beta(3)-adrenoceptors with pEC(50)=5.5 and intrinsic activity 0.74 with respect to (-)-isoprenaline (pEC(50)=5.9). (-)-RO363 competed for binding with [I-125]cyanopindolol at human beta(3)-adrenoceptors transfected into CHO cells with pK(i)=4.5. (-)-Isoprenaline (pk(i)=5.2) and (-)-CGP 12177A (pK(i)=6.1) also competed for binding at human beta(2)-adrenoceptors. 7 We conclude that under conditions used in this study, (-)-RO363 is a potent partial agonist for human beta(1)- and beta(3)-adrenoceptors and appears also to activate the third human atrial beta-adrenoceptor. (-)-RO363 relaxes mammalian gut through both beta(1)- and beta(3)-adrenoceptors. (-)-RO363, used as a beta(1)-adrenoceptor selective tool, confirms previous findings with (-)-noradrenaline that beta(1)-adrenoceptor mediated atrial effects are only slightly enhanced by chronic treatment of patients with beta-blockers. Chronic treatment with beta(1)-adrenoceptor-selective blockers does not significantly increase the density of human atrial beta(1)- and beta(2)-adrenoceptors.

Molecular adjuvant effects of a conformationally biased agonist elf human C5a anaphylatoxin

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Chinese hamster ovary cells produce sufficient recombinant insulin-like growth factor I to support growth in serum-free medium - Serum-free growth of IGF-I producing CHO cells

Insulin-like growth factor I has similar mitogenic effects to insulin, a growth factor required by most cells in culture, and it can replace insulin in serum-free formulations for some cells. Chinese Hamster Ovary cells grow well in serum-free medium with insulin and transferrin as the only exogenous growth factors. An alternative approach to addition of exogenous growth factors to serum-free medium is transfection of host cells with growth factor-encoding genes, permitting autocrine growth. Taking this approach, we constructed an IGF-I heterologous gene driven by the cytomegalovirus promoter, introduced it into Chinese Hamster Ovary cells and examined the growth characteristics of Insulin-like growth factor I-expressing clonal cells in the absence of the exogenous factor. The transfected cells secreted up to 500 ng/10(6) cells/day of mature Insulin-like growth factor I into the conditioned medium and as a result they grew autonomously in serum-free medium containing transferrin as the only added growth factor. This growth-stimulating effect, observed under both small and large scale culture conditions, was maximal since no further improvement was observed in the presence of exogenous insulin.

Isolated limb perfusion with melphalan for human melanoma xenografts in the hindlimb of nude rats: A surviving animal model

We have established a surviving model of isolated limb perfusion using xenografts of the human melanoma cell line MM 96L injected subcutaneously into the hindlimb of a nude rat, The femoral artery and vein were cannulated via the left renal artery and vein and the hind limb was isolated using tourniquets. The limb was perfused with Krebs Heinseleit buffer at 37 degrees C containing 4.7% bovine serum albumin at a constant flow rate of 4 mi per min for 30-60 min with 100% survival of the animals, Tumour vascularization and blood flow were demonstrated using vascular casts and [Cr-51]-microspheres. Following the addition of melphalan (15 or 100 mu g/ml), drug concentrations in the perfusate, tissues and systemic circulation were determined using high pressure liquid chromatography (HPLC), Systemic leakage, assessed using [I-125]albumin and melphalan and detected by a gamma-counter and HPLC respectively, was <0.5%. The melphalan concentration and tissue flow rate in the tumour deposits were 40 and 30% respectively, when compared with the surrounding subcutaneous tissue, At a dose of 15 mu g/ml, melphalan caused a reduction in tumour growth after 60 min perfusion, and a significant reduction in tumour size was seen when the melphalan dose was 100 mu g/ml. The surviving nude rat model of isolated limb perfusion for recurrent melanoma will allow examination of optimal perfusion conditions, along with the pharmacokinetics, pharmacodynamics and efficacy of melphalan and other drugs.