Molecular adjuvant effects of a conformationally biased agonist elf human C5a anaphylatoxin

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Biologically active conformer of the effector region of human C5a and modulatory effects of N-terminal receptor binding determinants on activity

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

E7 oncoprotein of human papillomavirus type 16 expressed constitutively in the epidermis has no effect on E7-specific B- or Th-repertoires or on the immune response induced or sustained after immunization with E7 protein

A line of FVB (H-2(q)) mice transgenic for the E6/E7 open reading frames of Human Papillomavirus type 16 driven from the alpha-A crystallin promoter expresses E7 mRNA in lens and skin epithelium. E7 protein is detectable in adult skin, coinciding with the development or inflammatory skin disease, which progresses to papillomata and squamous carcinomata in some mice. By examining the outcome of parenteral immunization with E7 protein, we sought to determine whether endogenous expression of E7 in skin had induced a preexisting immune outcome, i.e., specific immunity or tolerance, or whether the mice remain naive (''ignorant'') to E7. Our data show that the antibody response to defined E7 B-epitopes, the proliferative response to Th epitopes, and the delayed-type hypersensitivity (DTH) response to whole E7 did not differ between groups or young and old E6/E7 transgenic mice (likely having different degrees of lifetime exposure to E7 protein) or between E6/E7-transgenic and nontransgenic parental strain control mice. Although an E7-specific CTL response could not be induced in the H-2(q) background of these mice, incorporation of a D-b allele into the genome allowed comparison of D-b-restricted CTL responses in E6/E7 transgenic and nontransgenic mice. Experiments indicated that the E7-immunization-induced CTL response did not differ significantly between E6/E7 transgenic and nontransgenic mice. We interpret these results to indicate that in spite of expression of E7 protein in adult skin, E6/E7 transgenic mice remain immunologically naive (ignorant) of E7 epitopes presented by immunization. (C) 1997 Academic Press.

Peripheral blood chimerism following human liver transplantation

The aim of this study was to prospectively investigate the peak levels and kinetics of donor leucocyte chimerism in human recipients following liver transplantation, The peak levels of chimerism mere observed within the first 48 hours following transplantation and ranged from 0.15% to 20% of total peripheral blood mononuclear cells, In all but one patient, who developed graft versus host disease, there was an early peak level of chimerism that declined over time such that donor leukocytes mere only intermittently detectable after 3 to 4 weeks. In 8 patients who had no episodes of graft rejection, the peak level of donor leukocyte chimerism ranged from 1.3% to 20% (mean +/- SEM; 5.5% +/- 2.1%). In 3 patients who were treated for episodes of acute graft rejection during the first four postoperative weeks, the peak level of donor leukocyte chimerism ranged from 0.15% to 0.2% (0.18 +/- 0.02, P = .012), The results demonstrate a marked variation in the total number of donor leukocytes detectable in the peripheral blood early after liver transplantation and also, that lower levels of chimerism may be associated with lower rates of initial graft acceptance and a higher incidence of acute rejection.

Metabolic activation of aromatic amines by human pancreas

Epidemiologic studies have suggested that aromatic amines (and nitroaromatic hydrocarbons) may be carcinogenic for human pancreas, Pancreatic tissues from 29 organ donors (13 smokers, 16 non-smokers) were examined for their ability to metabolize aromatic amines and other carcinogens, Microsomes showed no activity for cytochrome P450 (P450) 1A2-dependent N-oxidation of 4-aminobiphenyl (ABP) or for the following activities (and associated P450s): aminopyrine N-demethylation and ethylmorphine N-demethylation (P450 3A4); ethoxyresorufin O-deethylation (P450 1A1) and pentoxyresorufin O-dealkylation (P450 2B6); p-nitrophenol hydroxylation and N-nitrosodimethylamine N-demethylation (P450 2E1); lauric acid omega-hydroxylation (P450 4A1); and 4-(methylnitrosamino)-1-(3-pyridyl-1-butanol) (NNAL) and 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) alpha-oxidation (P450 1A2, 2A6, 2D6). Antibodies were used to examine microsomal levels of P450 1A2, 2A6, 2C8/9/18/19, 2E1, 2D6, and 3A3/ 4/5/7 and epoxide hydrolase. Immunoblots detected only epoxide hydrolase at low levels; P450 levels were <1% of liver. Microsomal benzidine/prostaglandin hydroperoxidation activity was low. In pancreatic cytosols and microsomes, 4-nitrobiphenyl reductase activities were present at levels comparable to human liver. The O-acetyltransferase activity (AcCoA-dependent DNA-binding of [H-3]N-hydroxy-ABP) of pancreatic cytosols was high, about two-thirds the levels measured in human colon. Cytosols showed high activity for N-acetylation of p-aminobenzoic acid, but not of sulfamethazine, indicating that acetyltransferase-1 (NAT1) is predominantly expressed in this tissue. Cytosolic sulfotransferase was detected at low levels. Using P-32-post-labeling enhanced by butanol extraction, putative arylamine-DNA adducts were detected in most samples. Moreover, in eight of 29 DNA samples, a major adduct was observed that was chromatographically identical to the predominant ABP-DNA adduct, N-(deoxyguanosin-8-yl)-ABP. These results are consistent with a hypothesis that aromatic amines and nitroaromatic hydrocarbons may be involved in the etiology of human pancreatic cancer.

Modulation of human cardiac function through 4 beta-adrenoceptor populations

In human heart there is now evidence for the involvement of four beta-adrenoceptor populations, three identical to the recombinant beta(1)-, beta(2)- and beta(3)-adrenoceptors, and a fourth as yet uncloned putative beta-adrenoceptor population, which we designate provisionally as the cardiac putative beta(4)-adrenoceptor. This review described novel features of beta-adrenoceptors as modulators of cardiac systolic and diastolic function. We also discuss evidence for modulation by unoccupied beta(1)- and beta(2)-adrenoceptors. Human cardiac and recombinant beta(1)- and beta(2)-adrenoceptors are both mainly coupled to adenylyl cyclase through Gs protein, the latter more tightly than the former. Activation of both human beta(1)- and beta(2)-adrenoceptors not only increases cardiac force during systole but also hastens relaxation through cyclic AMP-dependent phosphorylation of phospholamban and troponin I, thereby facilitating diastolic function. Furthermore, both beta(1) and beta(2)-adrenoceptors can mediate experimental arrhythmias in human cardiac preparations elicited by noradrenaline and adrenaline. Human ventricular beta(3)-adrenoceptors appear to be coupled to a pertussis toxin-sensitive protein (Gi?). beta(3)-Adrenoceptor-selective agonists shorten the action potential and cause cardiodepression, suggesting direct coupling of a Gi protein to a K+ channel. In a variety of species, including man, cardiac putative beta(4)-adrenoceptors mediate cardiostimulant effects of non-conventional partial agonists, i.e. high affinity beta(1)- and beta(2)-adrenoceptor blockers that cause agonist effects at concentrations considerably higher than those that block these receptors. Putative beta(4)-adrenoceptors appear to be coupled positively to a cyclic AMP-dependent cascade and can undergo some desensitisation.

Melphalan dosing regimens for management of recurrent melanoma by isolated limb perfusion: Application of a physiological pharmacokinetic model based on melphalan distribution in the isolated perfused rat hindlimb

The optimal dosing schedule for melphalan therapy of recurrent malignant melanoma in isolated limb perfusions has been examined using a physiological pharmacokinetic model with data from isolated rat hindlimb perfusions (IRHP), The study included a comparison of melphalan distribution in IRHP under hyperthermia and normothermia conditions. Rat hindlimbs were perfused with Krebs-Henseleit buffer containing 4.7% bovine serum albumin at 37 or 41.5 degrees C at a flow rate of 4 ml/min. Concentrations of melphalan in perfusate and tissues were determined by high performance liquid chromatography with fluorescence detection, The concentration of melphalan in perfusate and tissues was linearly related to the input concentration. The rate and amount of melphalan uptake into the different tissues was higher at 41.5 degrees C than at 37 degrees C. A physiological pharmacokinetic model was validated from the tissue and perfusate time course of melphalan after melphalan perfusion. Application of the model involved the amount of melphalan exposure in the muscle, skin and fat in a recirculation system was related to the method of melphalan administration: single bolus > divided bolus > infusion, The peak concentration of melphalan in the perfusate was also related to the method of administration in the same order, Infusing the total dose of melphalan over 20 min during a 60 min perfusion optimized the exposure of tissues to melphalan whilst minimizing the peak perfusate concentration of melphalan. It is suggested that this method of melphalan administration may be preferable to other methods in terms of optimizing the efficacy of melphalan whilst minimizing the limb toxicity associated with its use in isolated limb perfusion.

Extracellular calcium stimulates Na+-dependent putrescine uptake in B16 melanoma cells

The regulation of putrescine transport in difluoromethylornithine-treated B16 melanoma cells by extracellular Ca2+ has been investigated. It was found that physiological concentrations of Ca2+ were essential for optimum uptake of putrescine and spermidine. Mg2+, albeit at higher concentrations, also could potentiate polyamine transport. The maximum rate of putrescine uptake increased from 1698 +/-: 67 pmol/min/mg DNA in the absence of Ca2+ to 3100 +/- 98 pmol/min/mg DNA in the presence of 0.5 mM Ca2+. There was no change in K-m. While Ca2+ enhanced transport of both putrescine and spermidine it did not affect the uptake of deoxyglucose, thymidine or leucine. Putrescine did not alter Ca2+ fluxes suggesting that the two cations do not share a common transport system. The effects of Ca2+ on putrescine uptake appeared to be mediated extracellularly firstly because Ca2+ did not potentiate putrescine uptake in the presence of A23187 and secondly, because the effects of Ca2+ were completely inhibited by the lanthanide Tb3+, which binds to calcium-dependent proteins and does not readily cross biological membranes. Ca2+ did not affect putrescine transport in the absence of extracellular Na+. Moreover, the rate of putrescine uptake in the absence of Ca2+ was similar to that in the absence of extracellular Na+. The results from this study indicate that polyamine transport is stimulated by extracellular Ca2+ and suggest that Ca2+ is required for activity of the Na+-dependent transporter only. This transporter appears to possess a regulatory binding site for divalent cations. (C) 1997 Elsevier Science Ltd.

Human leukemia inhibitory factor upregulates LDL receptors on liver cells and decreases serum cholesterol in the cholesterol-fed rabbit

In a previous study, we found that the cytokine (human) leukemia inhibitory factor (hLIF) significantly reduced plasma cholesterol levels and the accumulation of lipid in aortic tissues of cholesterol-fed rabbits after 4 weeks of treatment. The mechanisms by which this occurs were investigated in the present study. This involved examining the effect of hLIF on (1) the level of plasma cholesterol at different times throughout the 4-week treatment and diet period; (2) smooth muscle cell (SMC) and macrophage-derived foam cell formation in vitro; and (3) LDL receptor expression and uptake in the human hepatoma cell line HepG2. At time zero, an osmotic minipump (2-mL capacity; infusion rate, 2.5 mu L/h; 28 days) containing either hLIF (30 mu g.kg(-1).d(-1)) or saline was inserted into the peritoneal cavity of New Zealand White rabbits (N=24). Rabbits were divided into four groups of six animals each. Group 1 received a normal diet/saline; group 2, a normal diet/hLIF; group 3, a 1% cholesterol diet/saline; and group 4, a 1% cholesterol diet/hLIF. hLIF had no effect on the plasma lipids or artery wall of group 2 rabbits (normal diet). However, in group 4 rabbits, plasma cholesterol levels and the percent surface area of thoracic aorta covered by fatty streaks was decreased by approximate to 30% and 80%, respectively, throughout all stages of the 4-week treatment period. In vitro, hLIF failed to prevent lipoprotein uptake by either SMCs or macrophages (foam cell formation) when the cells were exposed to P-VLDL for 24 hours. In contrast, hLIF (100 ng/mL) added to cultured human hepatoma HepG2 cells induced a twofold or threefold increase in intracellular lipid accumulation in the medium containing 10% lipoprotein-deficient serum or 10% fetal calf serum, respectively. This was accompanied by a significant non-dose-dependent increase in LDL receptor expression in hLIF-treated HepG2 cells incubated with LDL (20 mu g/mL) when compared with controls (P

Expression of activated mutants of the human interleukin-3/interleukin-5 granulocyte-macrophage colony-stimulating factor receptor common beta subunit in primary hematopoietic cells induces factor-independent proliferation and differentiation

To date, several activating mutations have been discovered in the common signal-transducing subunit (h beta c) of the receptors for human granulocyte-macrophage colony-stimulating factor, interleukin-3, and interleukin-5. Two of these, Fl Delta and 1374N, result in a 37 amino acid duplication and a single amino acid substitution in the extracellular domain of h beta c, respectively. A third, V449E, results in a single amino acid substitution in the transmembrane domain, Previous studies comparing the activity of these mutants in different hematopoietic cell lines imply that the transmembrane and extracellular mutations act by different mechanisms and suggest the requirement for cell type-specific molecules in signalling. To characterize the ability of these mutant hpc subunits to mediate growth and differentiation of primary cells and hence investigate their oncogenic potential, we have expressed all three mutants in primary murine hematopoietic cells using retroviral transduction. It is shown that, whereas expression of either extracellular hpc mutant confers factor-independent proliferation and differentiation on cells of the neutrophil and monocyte lineages only, expression of the transmembrane mutant does so on these lineages as well as the eosinophil, basophil, megakaryocyte, and erythroid lineages, Factor-independent myeloid precursors expressing the transmembrane mutant display extended proliferation in liquid culture and in some cases yielded immortalized cell lines. (C) 1997 by The American Society of Hematology.

Methimazole and propylthiouracil equally cross the perfused human term placental lobule

Propylthiouracil (PTU) is widely believed to cross the placenta less freely than methimazole (MMI) and is therefore regarded as the preferred drug for treatment of hyperthyroidism in pregnancy. Clinical studies comparing the two drugs show, however, no differences in maternal or fetal thyroid function. We investigated transfer from the maternal to the fetal circuit in the isolated perfused term human placental lobule of low and high doses of PTU (4 mu g/mL and 40 mu g/mL) and MMI(1.5 mu g/mL and 15 mu g/mL) in protein-free perfusate and low doses of both drugs with addition of 40 g/L of bovine albumin. Both drugs readily crossed the placenta, reaching equilibrium in all experiments in about 2 h. Drug concentrations in the two circuits fitted a two compartmental model. Transfer kinetics for the two drugs were similar, nonsaturable, and unaffected by addition of albumin. Clearances (mL.min(-1).g(-1), means +/- SD) of PTU from maternal to fetal circuits were: 0.229 +/- 0.110, 0.216 +/- 0.065, and 0.170 +/- 0.032; and for transfer of MMI: 0.165 +/- 0.025, 0.232 +/- 0.153, and 0.174 +/- 0.009 (for low doses without, low doses with, and high doses without albumin, respectively). Clearances of PTU from fetal to maternal circuits were: 0.147 +/- 0.072, 0.109 +/- 0.014, and 0.116 +/- 0.028; and for transfer of MMI: 0.095 +/- 0.029, 0.122 +/- 0.088, and 0.12 +/- 0.005 (in the same experiments). There was no significant difference between drugs or drug doses and no effect of addition of albumin. We conclude that PTU and MMI have similar placental transfer kinetics.