Biological activity and metabolic clearance of recombinant human follicle stimulating hormone produced in Sp2/0 myeloma cells

Human follicle stimulating hormone is a pituitary glycoprotein that is essential for the maintenance of ovarian follicle development and testicular spermatogenesis. Like other members of the glycoprotein hormone family, it contains a common a subunit and a hormone specific beta subunit. Each subunit contains two glycosylation sites. The specific structures of the oligosaccharides of human follicle stimulating hormone have been shown to influence both the in vitro and in vivo bioactivity. Since the carbohydrate structure of a protein reflects the glycosylation apparatus of the host cells in which the protein is expressed, we examined the isoform profiles, in vitro bioactivity and metabolic clearance of a preparation of purified recombinant human follicle stimulating hormone derived from a stable, transfected Sp2/0 myeloma cell line, and pituitary human follicle stimulating hormone. Isoelectric focussing and chromatofocussing studies of human follicle stimulating hormone preparations both showed a more basic isoform profile for the recombinant human follicle stimulating hormone compared to that of pituitary human follicle stimulating hormone. The recombinant human follicle stimulating hormone had a significantly higher radioreceptor activity compared to that of pituitary human follicle stimulating hormone, consistent with a greater in vitro potency. Pharmacokinetic studies in rats indicated a similar terminal half life (124 min) to that of the pituitary human follicle stimulating hormone (119 min). Preliminary carbohydrate analysis showed recombinant human follicle stimulating hormone to contain high mannose and/or hybrid type, in addition to complex type carbohydrate chains, terminating with both alpha 2,3 and alpha 2,6 linked sialic acids. These results demonstrate that recombinant human follicle stimulating hormone made in the Sp2/0 myeloma cells is sialylated, has a more basic isoform profile, and has a greater in vitro biological potency compared to those of the pituitary human follicle stimulating hormone.

Processing of mutated human proinsulin to mature insulin in the non-endocrine cell line, CHO

Heterologous genes encoding proproteins, including proinsulin, generally produce mature protein when expressed in endocrine cells while unprocessed or partially processed protein is produced in non-endocrine cells. Proproteins, which are normally processed in the regulated pathway restricted to endocrine cells, do not always contain the recognition sequence for cleavage by furin, the endoprotease specific to the constitutive pathway, the principal protein processing pathway in non-endocrine cells. Human proinsulin consists of B-Chain-C-peptide-A-Chain and cleavage at the B/C and C/A junctions is required for processing. The B/C, but not the C/A junction, is recognised and cleaved in the constitutive pathway. We expressed a human proinsulin and a mutated proinsulin gene with an engineered furin recognition sequence at the C/A junction and compared the processing efficiency of the mutant and native proinsulin in Chinese Hamster Ovary cells. The processing efficiency of the mutant proinsulin was 56% relative to 0.7% for native proinsulin. However, despite similar levels of mRNA being expressed in both cell lines, the absolute levels of immunoreactive insulin, normalized against mRNA levels, were 18-fold lower in the mutant proinsulin-expressing cells. As a result, there was only a marginal increase in absolute levels of insulin produced by these cells. This unexpected finding may result from preferential degradation of insulin in non-endocrine cells which lack the protection offered by the secretory granules found in endocrine cells.

Mathematical constraints on a theory of human memory - Response

Colonius suggests that, in using standard set theory as the language in which to express our computational-level theory of human memory, we would need to violate the axiom of foundation in order to express meaningful memory bindings in which a context is identical to an item in the list. We circumvent Colonius's objection by allowing that a list item may serve as a label for a context without being identical to that context. This debate serves to highlight the value of specifying memory operations in set theoretic notation, as it would have been difficult if not impossible to formulate such an objection at the algorithmic level.

Molecular adjuvant effects of a conformationally biased agonist elf human C5a anaphylatoxin

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Biologically active conformer of the effector region of human C5a and modulatory effects of N-terminal receptor binding determinants on activity

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

Muscle-specific regulation of tropomyosin gene expression and myofibrillogenesis differs among muscle systems examined at metamorphosis of the gastropod Haliotis rufescens

The spatial and temporal association of muscle-specific tropomyosin gene expression, and myofibril assembly and degradation during metamorphosis is analyzed in the gastropod mollusc. Haliotis rufescens. Metamorphosis of tile planktonic larva to the benthic juvenile includes rearrangement and atrophy of specific larval muscles, and biogenesis of the new juvenile muscle system. The major muscle of the larva - the larval retractor muscle - reorganizes at metamorphosis, with two suites of cells having different fates. The ventral cells degenerate, while the dorsal cells become part of the developing juvenile mantle musculature. Prior to these changes in myofibrillar structure, tropomyosin mRNA prevalence declines until undetectable in the ventral cells, while increasing markedly in the dorsal cells. In the foot muscle and right shell muscle, tropomyosin mRNA levels remain relatively stable, even trough myofibril content increases. In a population of median mesoderm cells destined to form de novo the major muscle of the juvenile and adult (the columellar muscle), tropomyosin expression is initiated at 45 h after induction of metamorphosis. Myofibrillar filamentous actin is not detected in these cells until about 7 days later. Given that patterns of tropomyosin mRNA accumulation in relation to myofibril assembly and disassembly differ significantly among the four major muscle systems examined, we suggest that different regulatory mechanisms, probably operating at both transcriptional and post-transcriptional levels, control the biogenesis and atrophy of different larval and postlarval muscles at metamorphosis.

Isolated limb perfusion with melphalan for human melanoma xenografts in the hindlimb of nude rats: A surviving animal model

We have established a surviving model of isolated limb perfusion using xenografts of the human melanoma cell line MM 96L injected subcutaneously into the hindlimb of a nude rat, The femoral artery and vein were cannulated via the left renal artery and vein and the hind limb was isolated using tourniquets. The limb was perfused with Krebs Heinseleit buffer at 37 degrees C containing 4.7% bovine serum albumin at a constant flow rate of 4 mi per min for 30-60 min with 100% survival of the animals, Tumour vascularization and blood flow were demonstrated using vascular casts and [Cr-51]-microspheres. Following the addition of melphalan (15 or 100 mu g/ml), drug concentrations in the perfusate, tissues and systemic circulation were determined using high pressure liquid chromatography (HPLC), Systemic leakage, assessed using [I-125]albumin and melphalan and detected by a gamma-counter and HPLC respectively, was <0.5%. The melphalan concentration and tissue flow rate in the tumour deposits were 40 and 30% respectively, when compared with the surrounding subcutaneous tissue, At a dose of 15 mu g/ml, melphalan caused a reduction in tumour growth after 60 min perfusion, and a significant reduction in tumour size was seen when the melphalan dose was 100 mu g/ml. The surviving nude rat model of isolated limb perfusion for recurrent melanoma will allow examination of optimal perfusion conditions, along with the pharmacokinetics, pharmacodynamics and efficacy of melphalan and other drugs.

E7 oncoprotein of human papillomavirus type 16 expressed constitutively in the epidermis has no effect on E7-specific B- or Th-repertoires or on the immune response induced or sustained after immunization with E7 protein

A line of FVB (H-2(q)) mice transgenic for the E6/E7 open reading frames of Human Papillomavirus type 16 driven from the alpha-A crystallin promoter expresses E7 mRNA in lens and skin epithelium. E7 protein is detectable in adult skin, coinciding with the development or inflammatory skin disease, which progresses to papillomata and squamous carcinomata in some mice. By examining the outcome of parenteral immunization with E7 protein, we sought to determine whether endogenous expression of E7 in skin had induced a preexisting immune outcome, i.e., specific immunity or tolerance, or whether the mice remain naive (''ignorant'') to E7. Our data show that the antibody response to defined E7 B-epitopes, the proliferative response to Th epitopes, and the delayed-type hypersensitivity (DTH) response to whole E7 did not differ between groups or young and old E6/E7 transgenic mice (likely having different degrees of lifetime exposure to E7 protein) or between E6/E7-transgenic and nontransgenic parental strain control mice. Although an E7-specific CTL response could not be induced in the H-2(q) background of these mice, incorporation of a D-b allele into the genome allowed comparison of D-b-restricted CTL responses in E6/E7 transgenic and nontransgenic mice. Experiments indicated that the E7-immunization-induced CTL response did not differ significantly between E6/E7 transgenic and nontransgenic mice. We interpret these results to indicate that in spite of expression of E7 protein in adult skin, E6/E7 transgenic mice remain immunologically naive (ignorant) of E7 epitopes presented by immunization. (C) 1997 Academic Press.

Peripheral blood chimerism following human liver transplantation

The aim of this study was to prospectively investigate the peak levels and kinetics of donor leucocyte chimerism in human recipients following liver transplantation, The peak levels of chimerism mere observed within the first 48 hours following transplantation and ranged from 0.15% to 20% of total peripheral blood mononuclear cells, In all but one patient, who developed graft versus host disease, there was an early peak level of chimerism that declined over time such that donor leukocytes mere only intermittently detectable after 3 to 4 weeks. In 8 patients who had no episodes of graft rejection, the peak level of donor leukocyte chimerism ranged from 1.3% to 20% (mean +/- SEM; 5.5% +/- 2.1%). In 3 patients who were treated for episodes of acute graft rejection during the first four postoperative weeks, the peak level of donor leukocyte chimerism ranged from 0.15% to 0.2% (0.18 +/- 0.02, P = .012), The results demonstrate a marked variation in the total number of donor leukocytes detectable in the peripheral blood early after liver transplantation and also, that lower levels of chimerism may be associated with lower rates of initial graft acceptance and a higher incidence of acute rejection.

Metabolic activation of aromatic amines by human pancreas

Epidemiologic studies have suggested that aromatic amines (and nitroaromatic hydrocarbons) may be carcinogenic for human pancreas, Pancreatic tissues from 29 organ donors (13 smokers, 16 non-smokers) were examined for their ability to metabolize aromatic amines and other carcinogens, Microsomes showed no activity for cytochrome P450 (P450) 1A2-dependent N-oxidation of 4-aminobiphenyl (ABP) or for the following activities (and associated P450s): aminopyrine N-demethylation and ethylmorphine N-demethylation (P450 3A4); ethoxyresorufin O-deethylation (P450 1A1) and pentoxyresorufin O-dealkylation (P450 2B6); p-nitrophenol hydroxylation and N-nitrosodimethylamine N-demethylation (P450 2E1); lauric acid omega-hydroxylation (P450 4A1); and 4-(methylnitrosamino)-1-(3-pyridyl-1-butanol) (NNAL) and 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) alpha-oxidation (P450 1A2, 2A6, 2D6). Antibodies were used to examine microsomal levels of P450 1A2, 2A6, 2C8/9/18/19, 2E1, 2D6, and 3A3/ 4/5/7 and epoxide hydrolase. Immunoblots detected only epoxide hydrolase at low levels; P450 levels were <1% of liver. Microsomal benzidine/prostaglandin hydroperoxidation activity was low. In pancreatic cytosols and microsomes, 4-nitrobiphenyl reductase activities were present at levels comparable to human liver. The O-acetyltransferase activity (AcCoA-dependent DNA-binding of [H-3]N-hydroxy-ABP) of pancreatic cytosols was high, about two-thirds the levels measured in human colon. Cytosols showed high activity for N-acetylation of p-aminobenzoic acid, but not of sulfamethazine, indicating that acetyltransferase-1 (NAT1) is predominantly expressed in this tissue. Cytosolic sulfotransferase was detected at low levels. Using P-32-post-labeling enhanced by butanol extraction, putative arylamine-DNA adducts were detected in most samples. Moreover, in eight of 29 DNA samples, a major adduct was observed that was chromatographically identical to the predominant ABP-DNA adduct, N-(deoxyguanosin-8-yl)-ABP. These results are consistent with a hypothesis that aromatic amines and nitroaromatic hydrocarbons may be involved in the etiology of human pancreatic cancer.