205 resultados para Partial gene cloning
Resumo:
Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor. (c) 2006 Elsevier Inc. All rights reserved.
Resumo:
Sulfate is required for detoxification of xenobiotics such as acetaminophen (APAP), a leading cause of liver failure in humans. The NaS1 sulfate transporter maintains blood sulfate levels sufficiently high for sulforiation reactions to work effectively for drug detoxification. In the present study, we identified two loss-of-function polymorphisms in the human NaS1 gene and showed the Nas1-null mouse to be hypersensitive to APAP hepatotoxicity. APAP treatment led to increased liver damage and decreased hepatic glutathione levels in the hyposulfatemic Nas1-null mice compared with that in normosulfatemic wild-type mice. Analysis of urinary APAP metabolites revealed a significantly lower ratio of APAP-sulfate to APAP-glucuronide in the Nas1-null mice. These results suggest hyposulfatemia increases sensitivity to APAP-induced hepatotoxicity by decreasing the sulfonation capacity to metabolize APAP. In conclusion, the results of this study highlight the importance of plasma sulfate level as a key modulator of acetaminophen metabolism and suggest that individuals with reduced NaS1 sulfate transporter function would be more sensitive to hepatotoxic agents.
Resumo:
This paper reports the isolation of two putative D2R promoters from grey mullet, one 5' flanking and the other an intronic sequence immediately upstream of the first coding exon. Promoter activity of the intronic sequence was confirmed in vitro through functional analysis using luciferase as reporter gene. The functional characteristics of the region flanking the 5'-UTR is currently under investigation.
Resumo:
An efficient system is now in place for improving diverse sugarcane cultivars by genetic transformation, that is, the insertion of useful new genes into single cells followed by the regeneration of genetically modified (transgenic) plants. The method has already been used to introduce genes for resistance to several major diseases, insect pests and a herbicide, Field testing has begun, and research is underway to identify other genes for increased environmental stress resistance, agronomic efficiency and yield of sucrose or other valuable products. Experience in other crops has shown that genetically improved varieties which provide genuine environmental and consumer benefits are welcomed by producers and consumers. Substantial research is still needed, but these new gene technologies will reshape the sugar industry and determine the international competitive efficiency of producers.
Resumo:
The genetic mechanisms responsible for the formation of adrenocortical adenomas which autonomously produce aldosterone are largely unknown, The adrenal renin-angiotensin system has been implicated in the pathophysiology of these tumours, Angiotensin-converting enzyme (ACE) catalyses the generation of angiotensin II, and the insertion/deletion (I/D) polymorphism of the ACE gene regulates up to 50% of plasma and cellular ACE variability in humans. We therefore examined the genotypic and allelic frequency distributions of the ACE gene I/D polymorphism in 55 patients with aldosterone-producing adenoma, APA, (angiotensin-unresponsive APA n = 28, angiotensin-responsive APA n = 27), and 80 control subjects with no family history of hypertension, We also compared the ACE gene I/D polymorphism allelic pattern in matched tumour and peripheral blood DNA in the 55 patients with APA, The frequency of the D allele was 0.518 and 0.512 and the I allele was 0.482 and 0.488 in the APA and control subjects respectively, Genotypic and allelic frequency analysis found no significant differences between the groups, Examination of the matched tumour and peripheral blood DNA samples revealed the loss of the insertion allele in four of the 25 patients who were heterozygous for the ACE I/D genotype. The I/D polymorphism of the ACE gene does not appear to contribute to the biochemical and phenotypic characteristics of APA, however, the deletion of the insertion allele of the ACE gene I/D polymorphism in 16% of aldosterone-producing adenomas may represent the loss of a tumour suppressor gene/s or other genes on chromosome 17q which may contribute to tumorigenesis in APA.
Resumo:
We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
The spatial and temporal association of muscle-specific tropomyosin gene expression, and myofibril assembly and degradation during metamorphosis is analyzed in the gastropod mollusc. Haliotis rufescens. Metamorphosis of tile planktonic larva to the benthic juvenile includes rearrangement and atrophy of specific larval muscles, and biogenesis of the new juvenile muscle system. The major muscle of the larva - the larval retractor muscle - reorganizes at metamorphosis, with two suites of cells having different fates. The ventral cells degenerate, while the dorsal cells become part of the developing juvenile mantle musculature. Prior to these changes in myofibrillar structure, tropomyosin mRNA prevalence declines until undetectable in the ventral cells, while increasing markedly in the dorsal cells. In the foot muscle and right shell muscle, tropomyosin mRNA levels remain relatively stable, even trough myofibril content increases. In a population of median mesoderm cells destined to form de novo the major muscle of the juvenile and adult (the columellar muscle), tropomyosin expression is initiated at 45 h after induction of metamorphosis. Myofibrillar filamentous actin is not detected in these cells until about 7 days later. Given that patterns of tropomyosin mRNA accumulation in relation to myofibril assembly and disassembly differ significantly among the four major muscle systems examined, we suggest that different regulatory mechanisms, probably operating at both transcriptional and post-transcriptional levels, control the biogenesis and atrophy of different larval and postlarval muscles at metamorphosis.
Resumo:
A robust semi-implicit central partial difference algorithm for the numerical solution of coupled stochastic parabolic partial differential equations (PDEs) is described. This can be used for calculating correlation functions of systems of interacting stochastic fields. Such field equations can arise in the description of Hamiltonian and open systems in the physics of nonlinear processes, and may include multiplicative noise sources. The algorithm can be used for studying the properties of nonlinear quantum or classical field theories. The general approach is outlined and applied to a specific example, namely the quantum statistical fluctuations of ultra-short optical pulses in chi((2)) parametric waveguides. This example uses a non-diagonal coherent state representation, and correctly predicts the sub-shot noise level spectral fluctuations observed in homodyne detection measurements. It is expected that the methods used wilt be applicable for higher-order correlation functions and other physical problems as well. A stochastic differencing technique for reducing sampling errors is also introduced. This involves solving nonlinear stochastic parabolic PDEs in combination with a reference process, which uses the Wigner representation in the example presented here. A computer implementation on MIMD parallel architectures is discussed. (C) 1997 Academic Press.
Resumo:
All Tn5 insertion mutants of Xanthomonas albilineans, the cause of leaf scald disease of sugar cane, which failed to produce albicidin antibiotics failed to cause chlorosis in inoculated sugar cane but- remained resistant to albicidin. Southern analysis revealed that mutants deficient in albicidin production carried the transposon on different chromosomal restriction fragments spanning at least: 50 kb in the X. albilineans genome, which is larger than any reported cluster of genes involved in the production of a bacterial phytotoxin. Albicidin-resistant cosmid clones from a Tox(-) Tn5 insertion mutant did not carry the transposon, and the subcloned albicidin resistance gene did not hybridize to any of the restriction fragments carrying Tn5 in the Tox(-) mutants, indicating that the albicidin biosynthesis and resistance genes are not closely linked in X. albilineans.
Resumo:
Homocystinuria, due to a deficiency of the enzyme cystathionine beta-synthase (CBS), is an inborn error of sulphur-amino acid metabolism, This is an autosomal recessive disease which results in hyperhomocysteinaemia and a wide range of clinical features, including optic lens dislocation, mental retardation, skeletal abnormalities and premature thrombotic events, We report the identification of 5 missense mutations in the protein-coding region of the CBS gene from 3 patients with pyridoxine-nonresponsive homocystinuria. Reverse-transcription PCR was used to amplify CBS cDNA from each patient and the coding region was analysed by direct sequencing, The mutations detected included 3 novel (1058C --> T, 992C --> A and 1316G --> A) and 2 previously identified (430G --> A and 833C --> T) base alterations in the CBS cDNA, Each of these mutations predicts a single amino acid substitution in the CBS polypeptide, Appropriate cassettes of patient CBS cDNA, containing each of the above defined mutations, were used to replace the corresponding cassettes of normal CBS cDNA sequence within the bacterial expression vector pT7-7. These recombinant mutant and normal CBS constructs were expressed in Escherichia coli cells and the catalytic activities of the mutant proteins were compared with normal. All of the mutant proteins exhibited decreased catalytic activity in vitro, which confirmed the association between the individual mutation and CBS dysfunction in each patient.
Resumo:
Systemic injection of kainic acid (KA) results in characteristic behaviors and programmed cell death in some regions of the rat brain. We used KA followed by recovery at 4 degrees C to restrict damage to limbic structures and compared patterns of immediate early gene (IEG) expression and associated DNA binding activity in these damaged areas with that in spared brain regions. Male Wistar rats were injected with BA (12 mg/kg, ip) and kept at 4 degrees C for 5 h. This treatment reduced the severity of behaviors and restricted damage (observed by Nissl staining) to the CA1 and CA3 regions of the hippocampus and an area including the entorhinal cortex. DNA laddering, characteristic of apoptosis, was first evident in the hippocampus and the entorhinal cortex 18 and 22 h after RA, respectively. The pattern of IEG mRNA induction fell into three classes: IEGs that were induced in both damaged and spared areas (c-fos, fos B, jun B, and egr-1), IEGs that were induced specifically in the damaged areas (fra-2 and c-jun), and an IEG that was significantly induced by saline injection and/or the cold treatment (jun D). The pattern of immunoreactivity closely followed that of mRNA expression. Binding to the AP-1 and EGR DNA consensus sequences increased in all three regions studied. This study describes a unique modification of the animal model of ICA-induced neurotoxicity which may prove a useful tool for dissecting the molecular cascade that ultimately results in programmed cell death. (C) 1997 Academic Press.
Resumo:
is study examined the social adaptation of children with mild intellectual disability who were either (a) partially integrated into regular primary school classes, or (b) full-time in separate classes, All of the children were integrated in sport and play activities with the whole school. Consistent with previous research, children with intellectual disability were less socially accepted than were a matched group of control children. Children in partially integrated classes received more play nominations than those in separate classes, brit there was no greater acceptance as a best friend. On teachers' reports, disabled children had higher levels of inappropriate social behaviours, but there was no significant difference in appropriate behaviours. Self-assessments by integrated children were more negative than those by children in separate classes, and their peer-relationship satisfaction was lower. Ratings by disabled children of their satisfaction with peer relationships were associated with ratings of appropriate social skills by themselves and their teachers, and with self-ratings of negative behaviour. The study confirmed that partial integration can have negative consequences for children with an intellectual disability.