Effects of (-)-RO363 at human atrial beta-adrenoceptor subtypes, the human cloned beta(3)-adrenoceptor and rodent intestinal beta(3)-adrenoceptors

1 Chronic treatment of patients with beta-blockers causes atrial inotropic hyperresponsiveness through beta(2)-adrenoceptors, 5-HT4 receptors and H-2-receptors but apparently not through beta(1)-adrenoceptors despite data claiming an increased beta(1)-adrenoceptor density from homogenate binding studies. We have addressed the question of beta(1)-adrenoceptor sensitivity by determining the inotropic potency and intrinsic activity of the beta(1)-adrenoceptor selective partial agonist (-)-RO363 and by carrying out both homogenate binding and quantitative beta-adrenoceptor autoradiography in atria obtained from patients treated or not treated with beta-blockers. In the course of the experiments it became apparent that (-)-RO363 also may cause agonistic effects through the third atrial beta-adrenoceptor. To assess whether (-)-RO363 also caused agonistic effects through beta(3)-adrenoceptors we studied its relaxant effects in rat colon and guinea-pig ileum, as well as receptor binding and adenylyl cyclase stimulation of chinese hamster ovary (CHO) cells expressing human beta(3)-adrenoceptors. 2 beta-Adrenoceptors were labelled with (-)-[I-125]-cyanopindolol. The density of both beta(1)- and beta(2)-adrenoceptors was unchanged in the 2 groups, as assessed with both quantitative receptor autoradiography and homogenate binding. The affinities of (-)-RO363 for beta(1)-adrenoceptors (pK(i) = 8.0-7.7) and beta(2)-adrenoceptors (pK(i) = 6.1-5.8) were not significantly different in the two groups. 3 (-)-RO363 increased atrial force with a pEC(50) of 8.2 (beta-blocker treated) and 8.0 (non-beta-blocker treated) and intrinsic activity with respect to (-)-isoprenaline of 0.80 (beta-blocker treated) and 0.54 (non-beta-blocker treated) (P<0.001) and with respect to Ca2+ (7 mM) of 0.65 (beta-blocker treated) and 0.45 (non-beta-blocker treated) (P<0.01). The effects of (-)-RO363 were resistant to antagonism by the beta(2)-adrenoceptor antagonist, ICI 118,551 (50 nM). The effects of 0.3-10 nM (-)-RO363 were antagonized by 3-10 nM of the beta(1)-adrenoceptor selective antagonist CGP 20712A. The effects of 20-1000 nM (-)-RO363 were partially resistant to antagonism by 30-300 nM CGP 20712A. 4 (-)-RO363 relaxed the rat colon, partially precontracted by 30 mM KCl, with an intrinsic activity of 0.97 compared to (-)-isoprenaline. The concentration-effect curve to (-)-RO363 revealed 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.5 and fraction 0.66, the other resistant to (-)-propranolol (200 nM) with pEC(50)=5.6 and fraction 0.34 of maximal relaxation. 5 (-)-RO363 relaxed the longitudinal muscle of guinea-pig ileum, precontracted by 0.5 mu M histamine, with intrinsic activity of 1.0 compared to (-)-isoprenaline and through 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.7 and fraction 0.67, the other resistant to (-)-propranolol with pEC(50)=4.9 and fraction 0.33 of maximal relaxation. 6 (-)-RO363 stimulated the adenylyl cyclase of CHO cells expressing human beta(3)-adrenoceptors with pEC(50)=5.5 and intrinsic activity 0.74 with respect to (-)-isoprenaline (pEC(50)=5.9). (-)-RO363 competed for binding with [I-125]cyanopindolol at human beta(3)-adrenoceptors transfected into CHO cells with pK(i)=4.5. (-)-Isoprenaline (pk(i)=5.2) and (-)-CGP 12177A (pK(i)=6.1) also competed for binding at human beta(2)-adrenoceptors. 7 We conclude that under conditions used in this study, (-)-RO363 is a potent partial agonist for human beta(1)- and beta(3)-adrenoceptors and appears also to activate the third human atrial beta-adrenoceptor. (-)-RO363 relaxes mammalian gut through both beta(1)- and beta(3)-adrenoceptors. (-)-RO363, used as a beta(1)-adrenoceptor selective tool, confirms previous findings with (-)-noradrenaline that beta(1)-adrenoceptor mediated atrial effects are only slightly enhanced by chronic treatment of patients with beta-blockers. Chronic treatment with beta(1)-adrenoceptor-selective blockers does not significantly increase the density of human atrial beta(1)- and beta(2)-adrenoceptors.

Molecular adjuvant effects of a conformationally biased agonist elf human C5a anaphylatoxin

A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Biologically active conformer of the effector region of human C5a and modulatory effects of N-terminal receptor binding determinants on activity

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

A peptide-binding motif for I-A(g7), the class II major histocompatibility complex (MHC) molecule of NOD and Biozzi AB/H mice

The class II major histocompatibility complex molecule I-A(g7) is strongly linked to the development of spontaneous insulin-dependent diabetes mellitus (IDDM) in non obese diabetic mice and to the induction of experimental allergic encephalomyelitis in Biozzi AB/H mice. Structurally, it resembles the HLA-DQ molecules associated with human IDDM, in having a non-Asp residue at position 57 in its beta chain. To identify the requirements for peptide binding to I-A(g7) and thereby potentially pathogenic T cell epitopes, we analyzed a known I-A(g7)-restricted T cell epitope, hen egg white lysozyme (HEL) amino acids 9-27. NH2- and COOH-terminal truncations demonstrated that the minimal epitope for activation of the T cell hybridoma 2D12.1 was M12-R21 and the minimum sequence for direct binding to purified I-A(g7) M12-Y20/K13-R21. Alanine (A) scanning revealed two primary anchors for binding at relative positions (p) 6 (L) and 9 (Y) in the HEL epitope. The critical role of both anchors was demonstrated by incorporating L and Y in poly(A) backbones at the same relative positions as in the HEL epitope. Well-tolerated, weakly tolerated, and nontolerated residues were identified by analyzing the binding of peptides containing multiple substitutions at individual positions. Optimally, p6 was a large, hydrophobic residue (L, I, V, M), whereas p9 was aromatic and hydrophobic (Y or F) or positively charged (K, R). Specific residues were not tolerated at these and some other positions. A motif for binding to I-A(g7) deduced from analysis of the model HEL epitope was present in 27/30 (90%) of peptides reported to be I-A(g7)-restricted T cell epitopes or eluted from I-A(g7). Scanning a set of overlapping peptides encompassing human proinsulin revealed the motif in 6/6 good binders (sensitivity = 100%) and 4/13 weak or non-binders (specificity = 70%). This motif should facilitate identification of autoantigenic epitopes relevant to the pathogenesis and immunotherapy of IDDM.

Isolated limb perfusion with melphalan for human melanoma xenografts in the hindlimb of nude rats: A surviving animal model

We have established a surviving model of isolated limb perfusion using xenografts of the human melanoma cell line MM 96L injected subcutaneously into the hindlimb of a nude rat, The femoral artery and vein were cannulated via the left renal artery and vein and the hind limb was isolated using tourniquets. The limb was perfused with Krebs Heinseleit buffer at 37 degrees C containing 4.7% bovine serum albumin at a constant flow rate of 4 mi per min for 30-60 min with 100% survival of the animals, Tumour vascularization and blood flow were demonstrated using vascular casts and [Cr-51]-microspheres. Following the addition of melphalan (15 or 100 mu g/ml), drug concentrations in the perfusate, tissues and systemic circulation were determined using high pressure liquid chromatography (HPLC), Systemic leakage, assessed using [I-125]albumin and melphalan and detected by a gamma-counter and HPLC respectively, was <0.5%. The melphalan concentration and tissue flow rate in the tumour deposits were 40 and 30% respectively, when compared with the surrounding subcutaneous tissue, At a dose of 15 mu g/ml, melphalan caused a reduction in tumour growth after 60 min perfusion, and a significant reduction in tumour size was seen when the melphalan dose was 100 mu g/ml. The surviving nude rat model of isolated limb perfusion for recurrent melanoma will allow examination of optimal perfusion conditions, along with the pharmacokinetics, pharmacodynamics and efficacy of melphalan and other drugs.

E7 oncoprotein of human papillomavirus type 16 expressed constitutively in the epidermis has no effect on E7-specific B- or Th-repertoires or on the immune response induced or sustained after immunization with E7 protein

A line of FVB (H-2(q)) mice transgenic for the E6/E7 open reading frames of Human Papillomavirus type 16 driven from the alpha-A crystallin promoter expresses E7 mRNA in lens and skin epithelium. E7 protein is detectable in adult skin, coinciding with the development or inflammatory skin disease, which progresses to papillomata and squamous carcinomata in some mice. By examining the outcome of parenteral immunization with E7 protein, we sought to determine whether endogenous expression of E7 in skin had induced a preexisting immune outcome, i.e., specific immunity or tolerance, or whether the mice remain naive (''ignorant'') to E7. Our data show that the antibody response to defined E7 B-epitopes, the proliferative response to Th epitopes, and the delayed-type hypersensitivity (DTH) response to whole E7 did not differ between groups or young and old E6/E7 transgenic mice (likely having different degrees of lifetime exposure to E7 protein) or between E6/E7-transgenic and nontransgenic parental strain control mice. Although an E7-specific CTL response could not be induced in the H-2(q) background of these mice, incorporation of a D-b allele into the genome allowed comparison of D-b-restricted CTL responses in E6/E7 transgenic and nontransgenic mice. Experiments indicated that the E7-immunization-induced CTL response did not differ significantly between E6/E7 transgenic and nontransgenic mice. We interpret these results to indicate that in spite of expression of E7 protein in adult skin, E6/E7 transgenic mice remain immunologically naive (ignorant) of E7 epitopes presented by immunization. (C) 1997 Academic Press.

Peripheral blood chimerism following human liver transplantation

The aim of this study was to prospectively investigate the peak levels and kinetics of donor leucocyte chimerism in human recipients following liver transplantation, The peak levels of chimerism mere observed within the first 48 hours following transplantation and ranged from 0.15% to 20% of total peripheral blood mononuclear cells, In all but one patient, who developed graft versus host disease, there was an early peak level of chimerism that declined over time such that donor leukocytes mere only intermittently detectable after 3 to 4 weeks. In 8 patients who had no episodes of graft rejection, the peak level of donor leukocyte chimerism ranged from 1.3% to 20% (mean +/- SEM; 5.5% +/- 2.1%). In 3 patients who were treated for episodes of acute graft rejection during the first four postoperative weeks, the peak level of donor leukocyte chimerism ranged from 0.15% to 0.2% (0.18 +/- 0.02, P = .012), The results demonstrate a marked variation in the total number of donor leukocytes detectable in the peripheral blood early after liver transplantation and also, that lower levels of chimerism may be associated with lower rates of initial graft acceptance and a higher incidence of acute rejection.

Metabolic activation of aromatic amines by human pancreas

Epidemiologic studies have suggested that aromatic amines (and nitroaromatic hydrocarbons) may be carcinogenic for human pancreas, Pancreatic tissues from 29 organ donors (13 smokers, 16 non-smokers) were examined for their ability to metabolize aromatic amines and other carcinogens, Microsomes showed no activity for cytochrome P450 (P450) 1A2-dependent N-oxidation of 4-aminobiphenyl (ABP) or for the following activities (and associated P450s): aminopyrine N-demethylation and ethylmorphine N-demethylation (P450 3A4); ethoxyresorufin O-deethylation (P450 1A1) and pentoxyresorufin O-dealkylation (P450 2B6); p-nitrophenol hydroxylation and N-nitrosodimethylamine N-demethylation (P450 2E1); lauric acid omega-hydroxylation (P450 4A1); and 4-(methylnitrosamino)-1-(3-pyridyl-1-butanol) (NNAL) and 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) alpha-oxidation (P450 1A2, 2A6, 2D6). Antibodies were used to examine microsomal levels of P450 1A2, 2A6, 2C8/9/18/19, 2E1, 2D6, and 3A3/ 4/5/7 and epoxide hydrolase. Immunoblots detected only epoxide hydrolase at low levels; P450 levels were <1% of liver. Microsomal benzidine/prostaglandin hydroperoxidation activity was low. In pancreatic cytosols and microsomes, 4-nitrobiphenyl reductase activities were present at levels comparable to human liver. The O-acetyltransferase activity (AcCoA-dependent DNA-binding of [H-3]N-hydroxy-ABP) of pancreatic cytosols was high, about two-thirds the levels measured in human colon. Cytosols showed high activity for N-acetylation of p-aminobenzoic acid, but not of sulfamethazine, indicating that acetyltransferase-1 (NAT1) is predominantly expressed in this tissue. Cytosolic sulfotransferase was detected at low levels. Using P-32-post-labeling enhanced by butanol extraction, putative arylamine-DNA adducts were detected in most samples. Moreover, in eight of 29 DNA samples, a major adduct was observed that was chromatographically identical to the predominant ABP-DNA adduct, N-(deoxyguanosin-8-yl)-ABP. These results are consistent with a hypothesis that aromatic amines and nitroaromatic hydrocarbons may be involved in the etiology of human pancreatic cancer.

Modulation of human cardiac function through 4 beta-adrenoceptor populations

In human heart there is now evidence for the involvement of four beta-adrenoceptor populations, three identical to the recombinant beta(1)-, beta(2)- and beta(3)-adrenoceptors, and a fourth as yet uncloned putative beta-adrenoceptor population, which we designate provisionally as the cardiac putative beta(4)-adrenoceptor. This review described novel features of beta-adrenoceptors as modulators of cardiac systolic and diastolic function. We also discuss evidence for modulation by unoccupied beta(1)- and beta(2)-adrenoceptors. Human cardiac and recombinant beta(1)- and beta(2)-adrenoceptors are both mainly coupled to adenylyl cyclase through Gs protein, the latter more tightly than the former. Activation of both human beta(1)- and beta(2)-adrenoceptors not only increases cardiac force during systole but also hastens relaxation through cyclic AMP-dependent phosphorylation of phospholamban and troponin I, thereby facilitating diastolic function. Furthermore, both beta(1) and beta(2)-adrenoceptors can mediate experimental arrhythmias in human cardiac preparations elicited by noradrenaline and adrenaline. Human ventricular beta(3)-adrenoceptors appear to be coupled to a pertussis toxin-sensitive protein (Gi?). beta(3)-Adrenoceptor-selective agonists shorten the action potential and cause cardiodepression, suggesting direct coupling of a Gi protein to a K+ channel. In a variety of species, including man, cardiac putative beta(4)-adrenoceptors mediate cardiostimulant effects of non-conventional partial agonists, i.e. high affinity beta(1)- and beta(2)-adrenoceptor blockers that cause agonist effects at concentrations considerably higher than those that block these receptors. Putative beta(4)-adrenoceptors appear to be coupled positively to a cyclic AMP-dependent cascade and can undergo some desensitisation.

Growth hormone-binding protein in normal and pathologic gestation: Correlations with maternal diabetes and fetal growth

To date, measurements of GH-binding protein (GHBP) during human pregnancy have been carried out using;assays susceptible to interference by the elevated levels of human placental GH typical of late gestation. We recruited a large cohort of pregnant women (n = 140) for serial measurements of GHBP and used the ligand immunofunctional assay for GHBP. For normal gravidas, GHBP levels fell throughout gestation. Mean levels were 1.07 nmol/L (SE = 0.18) in the first trimester, 0.90 nmol/L (SE = 0.08) at 18-20 weeks, 0.73 nmol/L (SE = 0.05) at 28-30 weeks, and 0.62 nmol/L (SE = 0.06) at 36-38 weeks. GHBP levels in the first trimester correlated significantly with maternal body mass index (r = 0.58; P < 0.01). GHBP levels in pregnancies complicated by noninsulin-dependent diabetes mellitus (NIDDM) were substantially elevated at all gestational ages. The mean value in the first quarter (2.29 nmol/L) was more than double the normal mean (P < 0.01). In contrast, patients with insulin-dependent diabetes mellitus (IDDM) showed reduced GHBP concentrations at 36-38 weeks. The correlation between body mass index and GHBP is consistent with a metabolic role for GHBP during pregnancy, as is the dramatic elevation in GHBP observed in cases of NIDDM. At 36 weeks gestation, GHBP was significantly elevated (P < 0.01) in those women whose neonates had low birth weight (