256 resultados para sponge, luciferase, cloning, Suberites


Relevância:

10.00% 10.00%

Publicador:

Resumo:

Human sulfotransferase SULT1A1 is an important phase II xenobiotic metabolizing enzyme that is highly expressed in the liver and mediates the sulfonation of drugs, carcinogens, and steroids. Until this study, the transcriptional regulation of the SULT1A subfamily had been largely unexplored. Preliminary experiments in primary human hepatocytes showed that SULT1A mRNA levels were not changed in response to nuclear receptor activators, such as dexamethasone and 3-methylcolanthrene, unlike other metabolizing enzymes. Using HepG2 cells, the high activity of the TATA-less SULT1A1 promoter was shown to be dependent on the presence of Sp1 and Ets transcription factor binding sites (EBS), located within - 112 nucleotides from the transcriptional start site. The homologous promoter of the closely related SULT1A3 catecholamine sulfotransferase, which is expressed at negligible levels in the adult liver, displayed 70% less activity than SULT1A1. This was shown to be caused by a two-base pair difference in the EBS. The Ets transcription factor GA binding protein (GABP) was shown to bind the SULT1A1 EBS and could transactivate the SULT1A1 promoter in Drosophila melanogaster S2 cells. Cotransfection of Sp1 could synergistically enhance GABP-mediated activation by 10-fold. Although Sp1 and GABP alone could induce SULT1A3 promoter activity, the lack of the EBS on this promoter prevented a synergistic interaction between the two factors. This study reports the first insight into the transcriptional regulation of the SULT1A1 gene and identifies a crucial difference in regulation of the closely related SULT1A3 gene, which accounts for the two enzymes' differential expression patterns observed in the adult liver.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Sulfate is required for detoxification of xenobiotics such as acetaminophen (APAP), a leading cause of liver failure in humans. The NaS1 sulfate transporter maintains blood sulfate levels sufficiently high for sulforiation reactions to work effectively for drug detoxification. In the present study, we identified two loss-of-function polymorphisms in the human NaS1 gene and showed the Nas1-null mouse to be hypersensitive to APAP hepatotoxicity. APAP treatment led to increased liver damage and decreased hepatic glutathione levels in the hyposulfatemic Nas1-null mice compared with that in normosulfatemic wild-type mice. Analysis of urinary APAP metabolites revealed a significantly lower ratio of APAP-sulfate to APAP-glucuronide in the Nas1-null mice. These results suggest hyposulfatemia increases sensitivity to APAP-induced hepatotoxicity by decreasing the sulfonation capacity to metabolize APAP. In conclusion, the results of this study highlight the importance of plasma sulfate level as a key modulator of acetaminophen metabolism and suggest that individuals with reduced NaS1 sulfate transporter function would be more sensitive to hepatotoxic agents.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have observed previously that Ca2+ pump-mediated Ca2+ efflux is elevated in cultured aortic smooth muscle cells from spontaneously hypertensive rats compared to those from Wistar-Kyoto rat controls. The objective of this work was to determine if these strains differ in mRNA levels for the PMCA1 isoform of the plasma membrane Ca2+-ATPase and the SERCA2 isoform of the sarcoplasmic reticulum Ca2+-ATPase. mRNA levels were compared in cultured aortic smooth muscle cells from 10-week-old male rats. PMCA1 and SERCA2 mRNA levels were elevated in SHR compared to WKY. Angiotensin II increased the level of PMCA1 and SERCA2 mRNA in both strains. These studies provide further evidence for alterered Ca2+ homeostasis in hypertension at the level of Ca2+ transporting ATPases in the spontaneously hypertensive rat model. These data are also consistent with the hypothesis that the expression of these two Ca2+ pumps may be linked. (C) 1997 Academic Press

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. The GlyR comprises a pentameric complex that forms a chloride-selective transmembrane channel, which is predominantly expressed in the spinal cord and brain stem. We review the pharmacological and physiological properties of the GlyR and relate this information to more recent insights that have been obtained through the cloning and recombinant expression of the GlyR subunits. We also discuss insights into our understanding of GlyR structure and function that have been obtained by the genetic characterisation of various heritable disorders of glycinergic neurotransmission. (C) 1997 Elsevier Science Inc.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

We have studied gene expression during ascidian embryonic development using the technique of differential display and isolated partial cDNA sequences of 12 genes. Developmental regulation of these genes has been confirmed by northern hybridization analysis. Further cDNA cloning and sequence analysis of an mRNA that is present during gastrulation, neurulation and tailbud formation reveals that it encodes a novel serine protease containing a single kringle motif and catalytic domain. The spatial expression of this gene, designated Hmserp1, is restricted to precursor cells of the epidermis. The structure and expression of Hmsery1 is discussed in relation to possible functions during development.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

All Tn5 insertion mutants of Xanthomonas albilineans, the cause of leaf scald disease of sugar cane, which failed to produce albicidin antibiotics failed to cause chlorosis in inoculated sugar cane but- remained resistant to albicidin. Southern analysis revealed that mutants deficient in albicidin production carried the transposon on different chromosomal restriction fragments spanning at least: 50 kb in the X. albilineans genome, which is larger than any reported cluster of genes involved in the production of a bacterial phytotoxin. Albicidin-resistant cosmid clones from a Tox(-) Tn5 insertion mutant did not carry the transposon, and the subcloned albicidin resistance gene did not hybridize to any of the restriction fragments carrying Tn5 in the Tox(-) mutants, indicating that the albicidin biosynthesis and resistance genes are not closely linked in X. albilineans.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The results of this study challenge the widely held view that growth hormone (GH) acts only during the postnatal period. RNA phenotyping shows transcripts for the GH receptor and GH-binding protein in mouse preimplantation embryos of all stages from fertilized eggs (day 1) to blastocysts (day 4). An antibody specific to the cytoplasmic region of the GH receptor revealed receptor protein expression, first in two-cell embryos, the stage of activation of the embryonic genome (day 2), and in all subsequent stages, In cleavage-stage embryos this immunoreactivity was localized mainly to the nucleus, but clear evidence of membrane labeling was apparent in blastocysts. GH receptor immunoreactivity was also observed in cumulus cells associated with unfertilized oocytes but not in the unfertilized oocytes. The blastocyst receptor was demonstrated to be functional, exhibiting the classic bell-shaped dose-response curves for GH stimulation of both 3-O-methyl glucose transport and protein synthesis. Maximal stimulation of 40-50% was seen for both responses at less than 1 ng/ml recombinant GH, suggesting a role for maternal GK. However mRNA transcripts for GH were also detected from the morula stage (day 3) by using reverse transcription-PCR, and GH immunoreactivity was seen in blastocysts. These observations raise the possibility of a paracrine/autocrine GH loop regulating embryonic development in its earliest stages.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Cytokines are secreted proteins that regulate important cellular responses such as proliferation and differentiation(1). Key events in cytokine signal transduction are well defined: cytokines induce receptor aggregation, leading to activation of members of the JAK family of cytoplasmic tyrosine kinases. In turn, members af the STAT family of transcription factors are phosphorylated, dimerize and increase the transcription of genes with STAT recognition sites in their promoters(1-4). Less is known of how cytokine signal transduction is switched off. We have cloned a complementary DNA encoding a protein SOCS-1, containing an SH2-domain, by its ability to inhibit the macrophage differentiation of M1 cells in response to interleukin-6. Expression of SOCS-1 inhibited both interleukin-6-induced receptor phosphorylation and STAT activation. We have also cloned two-relatives of SOCS-1, named SOCS-2 and SOCS-3, which together with the previously described CIS (ref. 5) form a new family of proteins. Transcription of all four SOCS genes is increased rapidly in response to interleukin-6, in vitro and in vivo, suggesting they may act in a classic negative feedback loop to regulate cytokine signal transduction.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Familial Mediterranean fever (FMF) is a recessively inherited disorder characterized by dramatic episodes of fever and serosal inflammation. This report describes the cloning of the gene likely to cause FMF from a 115-kb candidate interval on chromosome 16p. Three different missense mutations were identified in affected individuals, but not in normals. Haplotype and mutational analyses disclosed ancestral relationships among carrier chromosomes in populations that have been separated for centuries. The novel gene encodes a 3.7-kb transcript that is almost exclusively expressed in granulocytes. The predicted protein, pyrin, is a member of a family of nuclear factors homologous to the Ro52 autoantigen. The cloning of the FMF gene promises to shed light on the regulation of acute inflammatory responses.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Albicidin phytotoxins are pathogenicity factors in a devastating disease of sugarcane known as leaf scald, caused by Xanthomonas albilineans. A gene (albD) from Pantoea dispersa has been cloned and sequenced and been shown to code for a peptide of 235 amino acids that detoxifies albicidin, The gene shows no significant homology at the DNA or protein level to any known sequence, but the gene product contains a GxSxG motif that is conserved in serine hydrolases, The AlbD protein, purified to homogeneity by means of a glutathione S-transferase gene fusion system, showed strong esterase activity on p-nitrophenyl butyrate and released hydrophilic products during detoxification of albicidins. AlbD hydrolysis of p-nitrophenyl butyrate and detoxification of albicidins required no complex cofactors, Both processes were strongly inhibited by phenylmethylsulfonyl fluoride, a serine enzyme inhibitor, These data strongly suggest that AlbD is an albicidin hydrolase, The enzyme detoxifies albicidins efficiently over a pH range from 5.8 to 8.0, with a broad temperature optimum from 15 to 35 degrees C, Expression of albD in transformed X. albilineans strains abolished the capacity to release albicidin toxins and to incite disease symptoms in sugarcane, The gene is a promising candidate for transfer into sugarcane to confer a form of disease resistance.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

1. Evidence for a 'putative beta(4)-adrenoceptor' originated over 20 years ago when cardiostimulant effects were observed to nonconventional partial agonists, These agonists were originally described as beta(1)- and beta(2)-adrenoceptor antagonists; however, they cause cardiostimulant effects at much higher concentrations than those required to block beta(1)- and beta(2)-adrenoceptors. Cardiostimulant effects of non-conventional partial agonists have been observed in mouse, rat, guinea-pig, cat, ferret and human heart tissues, 2. The receptor is expressed in several heart regions, including the sinoatrial node, atrium and ventricle, 3. The receptor is resistant to blockade by most antagonists that possess high affinity for beta(1)- and beta(2)- adrenoceptors, but is blocked with moderate affinity by (-)-bupranolol and CGP 20712A. 4. The receptor is pharmacologically distinct from the beta(3)-adrenoceptor. Micromolar concentrations of beta(3)-adrenoceptor agonists have no agonist or blocking activity, The receptor is also resistant to blockade by a beta(3)-adrenoceptor-selective antagonist. 5. The receptor mediates increases in cAMP levels and cAMP-dependent protein kinase (PK) A activity in cardiac tissues. Phosphodiesterase inhibition potentiates the positive chronotropic and inotropic effects of non-conventional partial agonists. 6. The receptor mediates hastening of atrial and ventricular relaxation, which is consistent with involvement of a cAMP-dependent pathway. 7. The non-conventional partial agonist (-)-[H-3]-CGP 12177A labels the cardiac putative beta(4)-adrenoceptor, Non-conventional partial agonists compete for binding with affinities that are closely similar to their agonist potencies, Catecholamines compete for binding in a stereoselective manner with a rank order of affinity of (-)-R0363 > (-)-isoprenaline > (-)-noradrenaline greater than or equal to (-)-adrenaline much greater than (-)-isoprenaline, suggesting that catecholamines can interact with the receptor. 8. The putative beta(4)-adrenoceptor appears to be coupled to the G(s)-adenylyl cyclase system, which could serve as a guide to its future cloning, Activation of the receptor may plausibly improve diastolic function but could also mediate arrhythmias.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

N-Acylisoxazol-5-ones lose carbon dioxide under photochemical and thermal conditions affording iminocarbenes which undergo intramolecular cyclisation through the oxygen of the acyl group to give oxazoles. Under photochemical conditions those acylisoxazolones with electron withdrawing groups at C-4 usually give high yields of oxazoles, while those with electron donating groups at C-4 give only poor yields: the reverse is observed under thermal conditions.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The technique of polymerase chain reaction (PCR) differential display was used to detect alterations in gene expression after chronic alcohol administration. Male Wistar rats were treated with ethanol vapor for 14 days. The cDNA generated from mRNA isolated from the hippocampi of ethanol-treated and control animals was compared by PCR differential display. A differentially expressed cDNA fragment was used to screen mRNA samples by Northern analysis. The level of a mRNA was significantly elevated (x 2.5) in the hippocampus, but not the cortex of alcohol-treated rats up to 48 hr after withdrawal. Sequence analysis of the cDNA fragment revealed an almost perfect homology to rat mitochondrial NADH dehydrogenase subunit 4 mRNA. The selective induction of this mRNA in alcohol-treated rat brain areas suggests altered metabolic processes and possible dysfunction of the mitochondria. The technique of PCR differential display may prove useful in further analysis of gene expression during alcohol dependence and withdrawal.