424 resultados para Human-centered computing


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We have established a surviving model of isolated limb perfusion using xenografts of the human melanoma cell line MM 96L injected subcutaneously into the hindlimb of a nude rat, The femoral artery and vein were cannulated via the left renal artery and vein and the hind limb was isolated using tourniquets. The limb was perfused with Krebs Heinseleit buffer at 37 degrees C containing 4.7% bovine serum albumin at a constant flow rate of 4 mi per min for 30-60 min with 100% survival of the animals, Tumour vascularization and blood flow were demonstrated using vascular casts and [Cr-51]-microspheres. Following the addition of melphalan (15 or 100 mu g/ml), drug concentrations in the perfusate, tissues and systemic circulation were determined using high pressure liquid chromatography (HPLC), Systemic leakage, assessed using [I-125]albumin and melphalan and detected by a gamma-counter and HPLC respectively, was <0.5%. The melphalan concentration and tissue flow rate in the tumour deposits were 40 and 30% respectively, when compared with the surrounding subcutaneous tissue, At a dose of 15 mu g/ml, melphalan caused a reduction in tumour growth after 60 min perfusion, and a significant reduction in tumour size was seen when the melphalan dose was 100 mu g/ml. The surviving nude rat model of isolated limb perfusion for recurrent melanoma will allow examination of optimal perfusion conditions, along with the pharmacokinetics, pharmacodynamics and efficacy of melphalan and other drugs.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A line of FVB (H-2(q)) mice transgenic for the E6/E7 open reading frames of Human Papillomavirus type 16 driven from the alpha-A crystallin promoter expresses E7 mRNA in lens and skin epithelium. E7 protein is detectable in adult skin, coinciding with the development or inflammatory skin disease, which progresses to papillomata and squamous carcinomata in some mice. By examining the outcome of parenteral immunization with E7 protein, we sought to determine whether endogenous expression of E7 in skin had induced a preexisting immune outcome, i.e., specific immunity or tolerance, or whether the mice remain naive (''ignorant'') to E7. Our data show that the antibody response to defined E7 B-epitopes, the proliferative response to Th epitopes, and the delayed-type hypersensitivity (DTH) response to whole E7 did not differ between groups or young and old E6/E7 transgenic mice (likely having different degrees of lifetime exposure to E7 protein) or between E6/E7-transgenic and nontransgenic parental strain control mice. Although an E7-specific CTL response could not be induced in the H-2(q) background of these mice, incorporation of a D-b allele into the genome allowed comparison of D-b-restricted CTL responses in E6/E7 transgenic and nontransgenic mice. Experiments indicated that the E7-immunization-induced CTL response did not differ significantly between E6/E7 transgenic and nontransgenic mice. We interpret these results to indicate that in spite of expression of E7 protein in adult skin, E6/E7 transgenic mice remain immunologically naive (ignorant) of E7 epitopes presented by immunization. (C) 1997 Academic Press.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to prospectively investigate the peak levels and kinetics of donor leucocyte chimerism in human recipients following liver transplantation, The peak levels of chimerism mere observed within the first 48 hours following transplantation and ranged from 0.15% to 20% of total peripheral blood mononuclear cells, In all but one patient, who developed graft versus host disease, there was an early peak level of chimerism that declined over time such that donor leukocytes mere only intermittently detectable after 3 to 4 weeks. In 8 patients who had no episodes of graft rejection, the peak level of donor leukocyte chimerism ranged from 1.3% to 20% (mean +/- SEM; 5.5% +/- 2.1%). In 3 patients who were treated for episodes of acute graft rejection during the first four postoperative weeks, the peak level of donor leukocyte chimerism ranged from 0.15% to 0.2% (0.18 +/- 0.02, P = .012), The results demonstrate a marked variation in the total number of donor leukocytes detectable in the peripheral blood early after liver transplantation and also, that lower levels of chimerism may be associated with lower rates of initial graft acceptance and a higher incidence of acute rejection.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Epidemiologic studies have suggested that aromatic amines (and nitroaromatic hydrocarbons) may be carcinogenic for human pancreas, Pancreatic tissues from 29 organ donors (13 smokers, 16 non-smokers) were examined for their ability to metabolize aromatic amines and other carcinogens, Microsomes showed no activity for cytochrome P450 (P450) 1A2-dependent N-oxidation of 4-aminobiphenyl (ABP) or for the following activities (and associated P450s): aminopyrine N-demethylation and ethylmorphine N-demethylation (P450 3A4); ethoxyresorufin O-deethylation (P450 1A1) and pentoxyresorufin O-dealkylation (P450 2B6); p-nitrophenol hydroxylation and N-nitrosodimethylamine N-demethylation (P450 2E1); lauric acid omega-hydroxylation (P450 4A1); and 4-(methylnitrosamino)-1-(3-pyridyl-1-butanol) (NNAL) and 4-(methylnitrosamino)1-(3-pyridyl)-1-butanone (NNK) alpha-oxidation (P450 1A2, 2A6, 2D6). Antibodies were used to examine microsomal levels of P450 1A2, 2A6, 2C8/9/18/19, 2E1, 2D6, and 3A3/ 4/5/7 and epoxide hydrolase. Immunoblots detected only epoxide hydrolase at low levels; P450 levels were <1% of liver. Microsomal benzidine/prostaglandin hydroperoxidation activity was low. In pancreatic cytosols and microsomes, 4-nitrobiphenyl reductase activities were present at levels comparable to human liver. The O-acetyltransferase activity (AcCoA-dependent DNA-binding of [H-3]N-hydroxy-ABP) of pancreatic cytosols was high, about two-thirds the levels measured in human colon. Cytosols showed high activity for N-acetylation of p-aminobenzoic acid, but not of sulfamethazine, indicating that acetyltransferase-1 (NAT1) is predominantly expressed in this tissue. Cytosolic sulfotransferase was detected at low levels. Using P-32-post-labeling enhanced by butanol extraction, putative arylamine-DNA adducts were detected in most samples. Moreover, in eight of 29 DNA samples, a major adduct was observed that was chromatographically identical to the predominant ABP-DNA adduct, N-(deoxyguanosin-8-yl)-ABP. These results are consistent with a hypothesis that aromatic amines and nitroaromatic hydrocarbons may be involved in the etiology of human pancreatic cancer.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In human heart there is now evidence for the involvement of four beta-adrenoceptor populations, three identical to the recombinant beta(1)-, beta(2)- and beta(3)-adrenoceptors, and a fourth as yet uncloned putative beta-adrenoceptor population, which we designate provisionally as the cardiac putative beta(4)-adrenoceptor. This review described novel features of beta-adrenoceptors as modulators of cardiac systolic and diastolic function. We also discuss evidence for modulation by unoccupied beta(1)- and beta(2)-adrenoceptors. Human cardiac and recombinant beta(1)- and beta(2)-adrenoceptors are both mainly coupled to adenylyl cyclase through Gs protein, the latter more tightly than the former. Activation of both human beta(1)- and beta(2)-adrenoceptors not only increases cardiac force during systole but also hastens relaxation through cyclic AMP-dependent phosphorylation of phospholamban and troponin I, thereby facilitating diastolic function. Furthermore, both beta(1) and beta(2)-adrenoceptors can mediate experimental arrhythmias in human cardiac preparations elicited by noradrenaline and adrenaline. Human ventricular beta(3)-adrenoceptors appear to be coupled to a pertussis toxin-sensitive protein (Gi?). beta(3)-Adrenoceptor-selective agonists shorten the action potential and cause cardiodepression, suggesting direct coupling of a Gi protein to a K+ channel. In a variety of species, including man, cardiac putative beta(4)-adrenoceptors mediate cardiostimulant effects of non-conventional partial agonists, i.e. high affinity beta(1)- and beta(2)-adrenoceptor blockers that cause agonist effects at concentrations considerably higher than those that block these receptors. Putative beta(4)-adrenoceptors appear to be coupled positively to a cyclic AMP-dependent cascade and can undergo some desensitisation.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

An isolated rat hindlimb perfusion model carrying xenografts of the human melanoma cell line MM96 was used to study the effects of perfusion conditions on melphalan distribution. Krebs-Henseleit buffer and Hartmann's solution containing 4.7% bovine serum albumin (BSA) or 2.8% dextran 40 were used as perfusates. Melphalan concentrations in perfusate, tumour nodules and normal tissues were measured using high-performance liquid chromatography (HPLC). Increasing the perfusion flow rates (from 4 to 8 mi min(-1)) resulted in higher tissue blood flow (determined with Cr-51-labelled microspheres) and melphalan uptake by tumour and normal tissues. me distribution of melphalan within tumour nodules and normal tissues was similar for both Krebs-Henseleit buffer and Hartmann's solution; however, tissue concentrations of melphalan were significantly higher for a perfusate containing 2.8% dextran 40 than for one containing 4.7% BSA. The melphalan concentration in the tumour was one-third of that found in the skin if the perfusate contained 4.7% BSA. In conclusion, this study has shown that a high perfusion flow enhances the delivery of melphalan into implanted tumour nodules and normal tissues, and a perfusate with low melphalan binding (no albumin) is preferred for maximum uptake of drug by the tumour.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In a previous study, we found that the cytokine (human) leukemia inhibitory factor (hLIF) significantly reduced plasma cholesterol levels and the accumulation of lipid in aortic tissues of cholesterol-fed rabbits after 4 weeks of treatment. The mechanisms by which this occurs were investigated in the present study. This involved examining the effect of hLIF on (1) the level of plasma cholesterol at different times throughout the 4-week treatment and diet period; (2) smooth muscle cell (SMC) and macrophage-derived foam cell formation in vitro; and (3) LDL receptor expression and uptake in the human hepatoma cell line HepG2. At time zero, an osmotic minipump (2-mL capacity; infusion rate, 2.5 mu L/h; 28 days) containing either hLIF (30 mu g.kg(-1).d(-1)) or saline was inserted into the peritoneal cavity of New Zealand White rabbits (N=24). Rabbits were divided into four groups of six animals each. Group 1 received a normal diet/saline; group 2, a normal diet/hLIF; group 3, a 1% cholesterol diet/saline; and group 4, a 1% cholesterol diet/hLIF. hLIF had no effect on the plasma lipids or artery wall of group 2 rabbits (normal diet). However, in group 4 rabbits, plasma cholesterol levels and the percent surface area of thoracic aorta covered by fatty streaks was decreased by approximate to 30% and 80%, respectively, throughout all stages of the 4-week treatment period. In vitro, hLIF failed to prevent lipoprotein uptake by either SMCs or macrophages (foam cell formation) when the cells were exposed to P-VLDL for 24 hours. In contrast, hLIF (100 ng/mL) added to cultured human hepatoma HepG2 cells induced a twofold or threefold increase in intracellular lipid accumulation in the medium containing 10% lipoprotein-deficient serum or 10% fetal calf serum, respectively. This was accompanied by a significant non-dose-dependent increase in LDL receptor expression in hLIF-treated HepG2 cells incubated with LDL (20 mu g/mL) when compared with controls (P

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To date, several activating mutations have been discovered in the common signal-transducing subunit (h beta c) of the receptors for human granulocyte-macrophage colony-stimulating factor, interleukin-3, and interleukin-5. Two of these, Fl Delta and 1374N, result in a 37 amino acid duplication and a single amino acid substitution in the extracellular domain of h beta c, respectively. A third, V449E, results in a single amino acid substitution in the transmembrane domain, Previous studies comparing the activity of these mutants in different hematopoietic cell lines imply that the transmembrane and extracellular mutations act by different mechanisms and suggest the requirement for cell type-specific molecules in signalling. To characterize the ability of these mutant hpc subunits to mediate growth and differentiation of primary cells and hence investigate their oncogenic potential, we have expressed all three mutants in primary murine hematopoietic cells using retroviral transduction. It is shown that, whereas expression of either extracellular hpc mutant confers factor-independent proliferation and differentiation on cells of the neutrophil and monocyte lineages only, expression of the transmembrane mutant does so on these lineages as well as the eosinophil, basophil, megakaryocyte, and erythroid lineages, Factor-independent myeloid precursors expressing the transmembrane mutant display extended proliferation in liquid culture and in some cases yielded immortalized cell lines. (C) 1997 by The American Society of Hematology.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Propylthiouracil (PTU) is widely believed to cross the placenta less freely than methimazole (MMI) and is therefore regarded as the preferred drug for treatment of hyperthyroidism in pregnancy. Clinical studies comparing the two drugs show, however, no differences in maternal or fetal thyroid function. We investigated transfer from the maternal to the fetal circuit in the isolated perfused term human placental lobule of low and high doses of PTU (4 mu g/mL and 40 mu g/mL) and MMI(1.5 mu g/mL and 15 mu g/mL) in protein-free perfusate and low doses of both drugs with addition of 40 g/L of bovine albumin. Both drugs readily crossed the placenta, reaching equilibrium in all experiments in about 2 h. Drug concentrations in the two circuits fitted a two compartmental model. Transfer kinetics for the two drugs were similar, nonsaturable, and unaffected by addition of albumin. Clearances (mL.min(-1).g(-1), means +/- SD) of PTU from maternal to fetal circuits were: 0.229 +/- 0.110, 0.216 +/- 0.065, and 0.170 +/- 0.032; and for transfer of MMI: 0.165 +/- 0.025, 0.232 +/- 0.153, and 0.174 +/- 0.009 (for low doses without, low doses with, and high doses without albumin, respectively). Clearances of PTU from fetal to maternal circuits were: 0.147 +/- 0.072, 0.109 +/- 0.014, and 0.116 +/- 0.028; and for transfer of MMI: 0.095 +/- 0.029, 0.122 +/- 0.088, and 0.12 +/- 0.005 (in the same experiments). There was no significant difference between drugs or drug doses and no effect of addition of albumin. We conclude that PTU and MMI have similar placental transfer kinetics.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Levels of recombinant human follicle stimulating hormone (r-hFSH) mRNA expressed under butyrate and zinc treatment were compared in two CHO-K1 derived cell lines. In King cells under the metallothionein promoter, butyrate induced the increase in both r-hFSH productivity (q(FSH)) and mRNA levels proportionally. In the presence of 1 mM butyrate and 40 mu M zinc, a 4-fold increase in q(FSH) and mRNA levels was achieved as compared to zinc (40) alone; this wasa approximately 6 times higher than in serum free medium. In Darren cells under the beta-actin promotor butyrate induced an increase in q(SFH) but not in mRNA levels.