209 resultados para Human Machine Interface (HMI)
Resumo:
The chi-conopeptides MrIA and MrIB are 13-residue peptides with two disulfide bonds that inhibit human and rat norepinephrine transporter systems and are of significant interest for the design of novel drugs involved in pain treatment. In the current study we have determined the solution structure of MrIA using NMR spectroscopy. The major element of secondary structure is a hairpin with the two strands connected by an inverse gamma-turn. The residues primarily involved in activity have previously been shown to be located in the turn region (Sharpe, I. A.; Palant, E.: Schroder, C. L; Kaye, D. M.; Adams, D. I.; Alewood, P. F.; Lewis, R. J. J Biol Client 2003, 278, 40317-40323), which appears to be more flexible than the beta-strands based on disorder in the ensemble of calculated structures. Analogues of MrIA with N-terminal truncations indicate that the N-terminal residues play a role in defining a stable conformation and the native disulfide connectivity. In particular, noncovalent interactions between Val3 and Hypl2 are likely to be involved in maintaining a stable conformation. The N-terminus also affects activity, as a single N-terminal deletion introduced additional pharmacology at rat vas deferens, while deleting the first two amino acids reduced chi-conopeptide potency. This article was originally published online as an accepted preprint. The Published Online date corresponds to the preprint version. You can request a copy of the preprint by entailing the Biopolymers editorial office at biopolymers@wiley.com (c) 2005 Wiley Periodicals, Inc.
Resumo:
In the present study, we analyzed how high-frequency repetitive transcranial magnetic stimulation (rTMS) of the primary motor hand area (M1-Hand) shapes anticipatory motor activity in frontal areas as indexed by the contingent negative variation (CNV). Eight right-handed volunteers received real or sham 5 Hz rTMS at an intensity of 90% resting motorthreshold (1500 stimuli per session). Real but not sham rTMS to left M1-Hand induced a site-specific increase in amplitude of the late component of the CNV at the electrode C3 overlaying the site of stimulation. The increase in pre-movement activity in the stimulated cortex may reflect an increase in facilitatory drive from connected motor areas, enhanced responsiveness of the stimulated cortex to these inputs or both. (c) 2005 Elsevier Ireland Ltd. All rights reserved.
Resumo:
In the course of daily living, humans frequently encounter situations in which a motor activity, once initiated, becomes unnecessary or inappropriate. Under such circumstances, the ability to inhibit motor responses can be of vital importance. Although the nature of response inhibition has been studied in psychology for several decades, its neural basis remains unclear. Using transcranial magnetic stimulation, we found that temporary deactivation of the pars opercularis in the right inferior frontal gyrus selectively impairs the ability to stop an initiated action. Critically, deactivation of the same region did not affect the ability to execute responses, nor did it influence physiological arousal. These findings confirm and extend recent reports that the inferior frontal gyrus is vital for mediating response inhibition.
Resumo:
Integral mass conservation was widely accepted for the solute coupling to solve solute redistribution during equiaxed solidification so far. The present study revealed that the integral form was invalid for moving boundary problems as it could not represent the mass balance at the moving interface. Accordingly, differential mass conservation at the solid/liquid interface was used to solve solute diffusion for spherical geometry. The model was applied for hydrogen diffusion in solidification to validate that the hydrogen enrichment was significant and depended on the growth rate. (c) 2006 American Institute of Physics.
Resumo:
Human follicle stimulating hormone is a pituitary glycoprotein that is essential for the maintenance of ovarian follicle development and testicular spermatogenesis. Like other members of the glycoprotein hormone family, it contains a common a subunit and a hormone specific beta subunit. Each subunit contains two glycosylation sites. The specific structures of the oligosaccharides of human follicle stimulating hormone have been shown to influence both the in vitro and in vivo bioactivity. Since the carbohydrate structure of a protein reflects the glycosylation apparatus of the host cells in which the protein is expressed, we examined the isoform profiles, in vitro bioactivity and metabolic clearance of a preparation of purified recombinant human follicle stimulating hormone derived from a stable, transfected Sp2/0 myeloma cell line, and pituitary human follicle stimulating hormone. Isoelectric focussing and chromatofocussing studies of human follicle stimulating hormone preparations both showed a more basic isoform profile for the recombinant human follicle stimulating hormone compared to that of pituitary human follicle stimulating hormone. The recombinant human follicle stimulating hormone had a significantly higher radioreceptor activity compared to that of pituitary human follicle stimulating hormone, consistent with a greater in vitro potency. Pharmacokinetic studies in rats indicated a similar terminal half life (124 min) to that of the pituitary human follicle stimulating hormone (119 min). Preliminary carbohydrate analysis showed recombinant human follicle stimulating hormone to contain high mannose and/or hybrid type, in addition to complex type carbohydrate chains, terminating with both alpha 2,3 and alpha 2,6 linked sialic acids. These results demonstrate that recombinant human follicle stimulating hormone made in the Sp2/0 myeloma cells is sialylated, has a more basic isoform profile, and has a greater in vitro biological potency compared to those of the pituitary human follicle stimulating hormone.
Resumo:
Heterologous genes encoding proproteins, including proinsulin, generally produce mature protein when expressed in endocrine cells while unprocessed or partially processed protein is produced in non-endocrine cells. Proproteins, which are normally processed in the regulated pathway restricted to endocrine cells, do not always contain the recognition sequence for cleavage by furin, the endoprotease specific to the constitutive pathway, the principal protein processing pathway in non-endocrine cells. Human proinsulin consists of B-Chain-C-peptide-A-Chain and cleavage at the B/C and C/A junctions is required for processing. The B/C, but not the C/A junction, is recognised and cleaved in the constitutive pathway. We expressed a human proinsulin and a mutated proinsulin gene with an engineered furin recognition sequence at the C/A junction and compared the processing efficiency of the mutant and native proinsulin in Chinese Hamster Ovary cells. The processing efficiency of the mutant proinsulin was 56% relative to 0.7% for native proinsulin. However, despite similar levels of mRNA being expressed in both cell lines, the absolute levels of immunoreactive insulin, normalized against mRNA levels, were 18-fold lower in the mutant proinsulin-expressing cells. As a result, there was only a marginal increase in absolute levels of insulin produced by these cells. This unexpected finding may result from preferential degradation of insulin in non-endocrine cells which lack the protection offered by the secretory granules found in endocrine cells.
Resumo:
Colonius suggests that, in using standard set theory as the language in which to express our computational-level theory of human memory, we would need to violate the axiom of foundation in order to express meaningful memory bindings in which a context is identical to an item in the list. We circumvent Colonius's objection by allowing that a list item may serve as a label for a context without being identical to that context. This debate serves to highlight the value of specifying memory operations in set theoretic notation, as it would have been difficult if not impossible to formulate such an objection at the algorithmic level.
Resumo:
1 Chronic treatment of patients with beta-blockers causes atrial inotropic hyperresponsiveness through beta(2)-adrenoceptors, 5-HT4 receptors and H-2-receptors but apparently not through beta(1)-adrenoceptors despite data claiming an increased beta(1)-adrenoceptor density from homogenate binding studies. We have addressed the question of beta(1)-adrenoceptor sensitivity by determining the inotropic potency and intrinsic activity of the beta(1)-adrenoceptor selective partial agonist (-)-RO363 and by carrying out both homogenate binding and quantitative beta-adrenoceptor autoradiography in atria obtained from patients treated or not treated with beta-blockers. In the course of the experiments it became apparent that (-)-RO363 also may cause agonistic effects through the third atrial beta-adrenoceptor. To assess whether (-)-RO363 also caused agonistic effects through beta(3)-adrenoceptors we studied its relaxant effects in rat colon and guinea-pig ileum, as well as receptor binding and adenylyl cyclase stimulation of chinese hamster ovary (CHO) cells expressing human beta(3)-adrenoceptors. 2 beta-Adrenoceptors were labelled with (-)-[I-125]-cyanopindolol. The density of both beta(1)- and beta(2)-adrenoceptors was unchanged in the 2 groups, as assessed with both quantitative receptor autoradiography and homogenate binding. The affinities of (-)-RO363 for beta(1)-adrenoceptors (pK(i) = 8.0-7.7) and beta(2)-adrenoceptors (pK(i) = 6.1-5.8) were not significantly different in the two groups. 3 (-)-RO363 increased atrial force with a pEC(50) of 8.2 (beta-blocker treated) and 8.0 (non-beta-blocker treated) and intrinsic activity with respect to (-)-isoprenaline of 0.80 (beta-blocker treated) and 0.54 (non-beta-blocker treated) (P<0.001) and with respect to Ca2+ (7 mM) of 0.65 (beta-blocker treated) and 0.45 (non-beta-blocker treated) (P<0.01). The effects of (-)-RO363 were resistant to antagonism by the beta(2)-adrenoceptor antagonist, ICI 118,551 (50 nM). The effects of 0.3-10 nM (-)-RO363 were antagonized by 3-10 nM of the beta(1)-adrenoceptor selective antagonist CGP 20712A. The effects of 20-1000 nM (-)-RO363 were partially resistant to antagonism by 30-300 nM CGP 20712A. 4 (-)-RO363 relaxed the rat colon, partially precontracted by 30 mM KCl, with an intrinsic activity of 0.97 compared to (-)-isoprenaline. The concentration-effect curve to (-)-RO363 revealed 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.5 and fraction 0.66, the other resistant to (-)-propranolol (200 nM) with pEC(50)=5.6 and fraction 0.34 of maximal relaxation. 5 (-)-RO363 relaxed the longitudinal muscle of guinea-pig ileum, precontracted by 0.5 mu M histamine, with intrinsic activity of 1.0 compared to (-)-isoprenaline and through 2 components, one antagonized by (-)-propranolol (200 nM) with pEC(50)=8.7 and fraction 0.67, the other resistant to (-)-propranolol with pEC(50)=4.9 and fraction 0.33 of maximal relaxation. 6 (-)-RO363 stimulated the adenylyl cyclase of CHO cells expressing human beta(3)-adrenoceptors with pEC(50)=5.5 and intrinsic activity 0.74 with respect to (-)-isoprenaline (pEC(50)=5.9). (-)-RO363 competed for binding with [I-125]cyanopindolol at human beta(3)-adrenoceptors transfected into CHO cells with pK(i)=4.5. (-)-Isoprenaline (pk(i)=5.2) and (-)-CGP 12177A (pK(i)=6.1) also competed for binding at human beta(2)-adrenoceptors. 7 We conclude that under conditions used in this study, (-)-RO363 is a potent partial agonist for human beta(1)- and beta(3)-adrenoceptors and appears also to activate the third human atrial beta-adrenoceptor. (-)-RO363 relaxes mammalian gut through both beta(1)- and beta(3)-adrenoceptors. (-)-RO363, used as a beta(1)-adrenoceptor selective tool, confirms previous findings with (-)-noradrenaline that beta(1)-adrenoceptor mediated atrial effects are only slightly enhanced by chronic treatment of patients with beta-blockers. Chronic treatment with beta(1)-adrenoceptor-selective blockers does not significantly increase the density of human atrial beta(1)- and beta(2)-adrenoceptors.
Resumo:
A conformationally biased decapeptide agonist of human C5a anaphylatoxin (YSFKPMPLaR) was used as a molecular adjuvant in stimulating Ab responses against peptide epitopes derived from human MUC1 glycoprotein and the human mu and kappa opioid receptors. C57BL6 mice were immunized with the MUC1 epitope (YKQGGFLGL); the C5a agonist (YSFKPMPLaR); YSFKPMPLaR and YKQGGFLGL together, but unconjugated; a C5a-active, MUC1 epitope construct (YKQGGFLGLYSFKPMPLaR); and a C5a-inactive, reversed moiety construct (YSFKPMPLaRYKQGGFLGL). High Ab titers specific for the MUC1 epitope were observed Only in mice immunized with the C5a-active epitope construct. Similar results were obtained in BALB/c mice immunized with the C5a-active, MUC1 epitope construct, Abs from the sera of the C57BL6 mice were predominately of the IgG2a, IgC2b, and IgM isotypes and were reactive against human recombinant MUC1 and MUC1 expressed by the Panc-1 M1F.15 pancreatic cell line, When compared with the corresponding KLH-epitope conjugates in C57BL6 mice, the epitope-C5a agonist constructs produced titers of specific IgG Abs of isotypes distinct from those generated by the keyhole limpet hemocyanin-epitope conjugates, Rabbits immunized with a mu opioid receptor epitope-C5a agonist construct (GDLSDPCGNRTNLGGRDSLYSFKPMPLaR) or a kappa opioid receptor epitope-C5a agonist construct (FPGWAEPDSNGSEDAQLYSFKPMPLaR) generated high titer, epitope-specific Ab responses, Ab titers generated in response to the opioid epitope-C5a agonist constructs were comparable to those generated by the opioid KLH-epitope conjugates, The results of this study are discussed in terms of possible mechanisms by which the conformationally biased C5a agonist serves as a molecular adjuvant.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
A conformationally biased decapeptide agonist of human C5a (C5a(65-74)Y65,F67,P69,P71,D-Ala73 or YSFKPMPLaR) was used as a functional probe of the C5a receptor (C5aR) in order to understand the conformational features in the C-terminal effector region of C5a that are important for C5aR binding and signal transduction. YSFKPMPLaR was a potent, full agonist of C5a, but at higher concentrations had a superefficacious effect compared to the natural factor. The maximal efficacy of this analogue was 216 +/- 56% that of C5a in stimulating the release of beta-glucuronidase from human neutrophils. C5aR activation and binding curves both occurred in the same concentration range with YSFKPMPLaR, characteristics not observed with natural C5a or more conformationally flexible C-terminal agonists. YSFKPMPLaR was then used as a C-terminal effector template onto which was synthesized various C5aR binding determinants from the N-terminal core domain of the natural factor. In general, the presence of N-terminal binding determinants had little effect on either potency or binding affinity when the C-terminal effector region was presented to the C5aR in this biologically active conformation. However, one peptide, C5a(12-20)-Ahx-YSFKPMPLaR, expressed a 100-fold increase in affinity for the neutrophil C5aR and a 6-fold increase in potency relative to YSFKPMPLaR. These analyses showed that the peptides used in this study have up to 25% of the potency of C5a in human fetal artery and up to 5% of the activity of C5a in the PMN enzyme release assay.