255 resultados para AMPLIFIED ANALYSIS
Resumo:
Obesity affects aspects of glucose homeostasis such as insulin secretion and insulin sensitivity. Hormones secreted by adipocytes like leptin mediate the metabolic consequences of obesity. Incretin hormones like glucagon-like peptide-1 (GLP-1) increase insulin secretion in response to changes in blood glucose concentration and have been proposed to regulate insulin secretion in fasting, overweight dogs. The aim of this study was to examine hormonal mechanisms by which adiposity alters glucose homeostasis, plasma insulin concentration, and insulin sensitivity in spontaneously overweight dogs.
Resumo:
Oral squamous cell carcinoma (OSCC) is associated with high morbidity and mortality which is due, at least in part, to late detection. Precancerous and cancerous oral lesions may mimic any number of benign oral lesions, and as such may be left without investigation and treatment until they are well advanced. Over the past several years there has been renewed interest in oral cytology as an adjuvant clinical tool in the investigation of oral mucosal lesions. The purpose of the present study was to compare the usefulness of ploidy analysis after Feulgen stained cytological thin-prep specimens with traditional incisional biopsy and routine histopathological examination for the assessment of the pre-malignant potential of oral mucosal lesions. An analysis of the cytological specimens was undertaken with virtual microscopy which allowed for rapid and thorough analysis of the complete cytological specimen. 100 healthy individuals between 30 and 70 years of age, who were non-smokers, non-drinkers and not taking any medication, had cytological specimens collected from both the buccal mucosa and lateral margin of tongue to establish normal cytology parameters within a control population. Patients with a presumptive clinical diagnosis of lichen planus, leukoplakia or OSCC had lesional cytological samples taken prior to their diagnostic biopsy. Standardised thin preparations were prepared and each specimen stained by both Feuglen and Papanicolau methods. High speed scanning of the complete slide at 40X magnification was undertaken using the Aperio Scanscope TM and the green channel of the resultant image was analysed after threshold segmentation to isolate only nuclei and the integrated optical density of each nucleus taken as a gross measure of the DNA content (ploidy). Preliminary results reveal that ploidy assessment of oral cytology holds great promise as an adjunctive prognostic factor in the analysis of the malignant potential of oral mucosal lesions.
Resumo:
The importance of overweight as a risk factor for coronary heart disease (CHD) remains unsettled. We estimated the relative risk (RR) for CHD associated with underweight (body mass index, BMI < 20 kg/m2), overweight (25 – 30 kg/m2) and obesity (= 30 kg/m2), compared with normal weight (20 – 25 kg/m2) in a random effects meta-analysis of 30 prospective studies, including 389,239 healthy, predominantly Caucasian persons. We also explored sources of heterogeneity between studies and examined effects of systematic adjustment for confounding and intermediary variables. Pooled age-, sex- and smoking-adjusted RRs (95% confidence interval) for overweight, obesity and underweight compared with normal weight were 1.33 (1.24 – 1.43), 1.69 (1.44 – 1.99) and 1.01 (0.85 – 1.20), respectively. Stratified analyses showed that pooled RRs for BMI were higher for studies with longer follow-up (= vs. < 15 years) and younger populations (< vs. = 60 years). Additional adjustment for blood pressure, cholesterol levels and physical activity decreased the RR per 5 BMI units from 1.28 (1.21 – 1.34) to 1.16 (1.11 – 1.21). We conclude that overweight and obesity are associated with a substantially increased CHD risk in Caucasians, whereas underweight is not. Prevention and reduction of overweight and obesity, therefore, remain of importance for preventing CHD.
Resumo:
An important consideration in the development of mathematical models for dynamic simulation, is the identification of the appropriate mathematical structure. By building models with an efficient structure which is devoid of redundancy, it is possible to create simple, accurate and functional models. This leads not only to efficient simulation, but to a deeper understanding of the important dynamic relationships within the process. In this paper, a method is proposed for systematic model development for startup and shutdown simulation which is based on the identification of the essential process structure. The key tool in this analysis is the method of nonlinear perturbations for structural identification and model reduction. Starting from a detailed mathematical process description both singular and regular structural perturbations are detected. These techniques are then used to give insight into the system structure and where appropriate to eliminate superfluous model equations or reduce them to other forms. This process retains the ability to interpret the reduced order model in terms of the physico-chemical phenomena. Using this model reduction technique it is possible to attribute observable dynamics to particular unit operations within the process. This relationship then highlights the unit operations which must be accurately modelled in order to develop a robust plant model. The technique generates detailed insight into the dynamic structure of the models providing a basis for system re-design and dynamic analysis. The technique is illustrated on the modelling for an evaporator startup. Copyright (C) 1996 Elsevier Science Ltd
Resumo:
In this second paper, the three structural measures which have been developed are used in the modelling of a three stage centrifugal synthesis gas compressor. The goal of this case study is to determine the essential mathematical structure which must be incorporated into the compressor model to accurately model the shutdown of this system. A simple, accurate and functional model of the system is created via three structural measures. It was found that the model can be correctly reduced into its basic modes and that the order of the differential system can be reduced from 51(st) to 20(th). Of the 31 differential equational 21 reduce to algebraic relations, 8 become constants and 2 can be deleted thereby increasing the algebraic set from 70 to 91 equations. An interpretation is also obtained as to which physical phenomena are dominating the dynamics of the compressor add whether the compressor will enter surge during the shutdown. Comparisons of the reduced model performance against the full model are given, showing the accuracy and applicability of the approach. Copyright (C) 1996 Elsevier Science Ltd
Resumo:
The technical reliability (i.e., interinstrument and interoperator reliability) of three SEAC-swept frequency bioimpedance monitors was assessed for both errors of measurement and associated analyses. In addition, intraoperator and intrainstrument variability was evaluated for repeat measures over a 4-hour period. The measured impedance values from a range of resistance-capacitance circuits were accurate to within 3% of theoretical values over a range of 50-800 ohms. Similarly, phase was measured over the range 1 degrees-19 degrees with a maximum deviation of 1.3 degrees from the theoretical value. The extrapolated impedance at zero frequency was equally well determined (+/-3%). However, the accuracy of the extrapolated value at infinite frequency was decreased, particularly at impedances below 50 ohms (approaching the lower limit of the measurement range of the instrument). The interinstrument/operator variation for whole body measurements were recorded on human volunteers with biases of less than +/-1% for measured impedance values and less than 3% for phase. The variation in the extrapolated values of impedance at zero and infinite frequencies included variations due to operator choice of the analysis parameters but was still less than +/-0.5%. (C) 1997 Wiley-Liss, Inc.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
Although planning is important for the functioning of patients with dementia of the Alzheimer Type (DAT), little is known about response programming in DAT. This study used a cueing paradigm coupled with quantitative kinematic analysis to document the preparation and execution of movements made by a group of 12 DAT patients and their age and sex matched controls. Participants connected a series of targets placed upon a WACOM SD420 graphics tablet, in response to the pattern of illumination of a set of light emitting diodes (LEDs). In one condition, participants could programme the upcoming movement, whilst in another they were forced to reprogramme this movement on-line (i.e. they were not provided with advance information about the location of the upcoming target). DAT patients were found to have programming deficits, taking longer to initiate movements; particularly in the absence of cues. While problems spontaneously programming a movement might cause a greater reliance upon on-line guidance, when both groups were required to guide the movement on-line, DAT patients continued to show slower and less efficient movements implying declining sensori-motor function; these differences were not simply due to strategy or medication status. (C) 1997 Elsevier Science Ltd.
Resumo:
Biologic valve re-replacement was examined in a series of 1343 patients who underwent aortic valve replacement at The Prince Charles Hospital, Brisbane, with a cryopreserved or 4 degrees C stored allograft valve or a xenograft valve, A parametric model approach was used to simultaneously model the competing risks of death without re-replacement and re-replacement before death, One hundred eleven patients underwent a first re-replacement for a variety of reasons (69 patients with xenograft valves, 28 patients with 4 degrees C stored allograft valves, and 14 patients with cryopreserved allograft valves), By multivariable analysis younger age at operation was associated with xenograft, 4 degrees C stored allograft, and cryopreserved allograft valve re-replacement, However, this effect was examined in the context of longer survival of younger patients, which increases their exposure to the risk of re-replacement as compared with that in older patients whose decreased survival reduced their probability of requiring valve re-replacement, In patients older than 60 years at the time of aortic valve replacement, the probability of re-replacement (for any reason) before death was similar for xenografts and cryopreserved allograft valves but higher for 4 degrees C stored valves, However, in patients younger than 60 years, the probability of re-replacement at any time during the remainder of the life of the patient was lower with the cryopreserved allograft valve compared with the xenograft valve and 4 degrees C stored allografts.
Resumo:
The classification rules of linear discriminant analysis are defined by the true mean vectors and the common covariance matrix of the populations from which the data come. Because these true parameters are generally unknown, they are commonly estimated by the sample mean vector and covariance matrix of the data in a training sample randomly drawn from each population. However, these sample statistics are notoriously susceptible to contamination by outliers, a problem compounded by the fact that the outliers may be invisible to conventional diagnostics. High-breakdown estimation is a procedure designed to remove this cause for concern by producing estimates that are immune to serious distortion by a minority of outliers, regardless of their severity. In this article we motivate and develop a high-breakdown criterion for linear discriminant analysis and give an algorithm for its implementation. The procedure is intended to supplement rather than replace the usual sample-moment methodology of discriminant analysis either by providing indications that the dataset is not seriously affected by outliers (supporting the usual analysis) or by identifying apparently aberrant points and giving resistant estimators that are not affected by them.
Resumo:
Chemorheology (and thus process modeling) of highly filled thermosets used in integrated circuit (IC) packaging has been complicated by their highly filled nature, fast kinetics of curing, and viscoelastic nature. This article summarizes a more thorough chemorheological analysis of a typical IC packaging thermoset material, including novel isothermal and nonisothermal multiwave parallel-plate chemorheology. This new chemorheological analysis may be used to optimize existing and design new IC packaging processes. (C) 1997 John Wiley & Sons, Inc.