50 resultados para Triplet repeat expansion


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Recent reports have shown neurodegenerative disorders to be associated with abnormal expansions of a CAG trinucleotide repeat allele at various autosomal loci. While normal chromosomes have 14 to 44 repeats, disease chromosomes may have 60 to 84 repeats. The number of CAG repeats on mutant chromosomes correlates with increasing severity of disease or decreasing age at onset of symptoms. Since we are interested in identifying the many quantitative trait loci (QTL) influencing brain functioning, we examined the possibility that the number of CAG repeats in the normal size range at these loci are relevant to "normal" neural functioning. We have used 150 pairs of adolescent (aged 16 years) twins and their parents to examine allele size at the MJD, SCA1, and DRPLA loci in heterozygous normal individuals. These are part of a large ongoing project using cognitive and physiological measures to investigate the genetie influences on cognition, and an extensive protocol of tests is employed to assess some of the key components of intellectual functioning. This study selected to examine full-scale psychometric IQ (FSIQ) and a measure of information processing (choice reaction time) and working memory (slow wave amplitude). CAG repeat size was determined on an ABI Genescan system following multiplex PCR amplification. Quantitative genetic analyses were performed to determine QTL effects of MJD, SCA1, and DRPLA on cognitive functioning. Analyses are in progress and will be discussed.

Relevância:

90.00% 90.00%

Publicador:

Resumo:

Kennedy's disease (spinobulbar muscular atrophy) is an X-linked form of motor neuron disease affecting adult males carrying a CAG trinucleotide repeat expansion within the androgen receptor gene. While expression of Kennedy's disease is thought to be confined to males carrying the causative mutation, subclinical manifestations have been reported in a few female carriers of the disease. The reasons that females are protected from the disease are not clear, especially given that all other diseases caused by CAG expansions display dominant expression. In the current study, we report the identification of a heterozygote female carrying the Kennedy's disease mutation who was clinically diagnosed with motor neuron disease. We describe analysis of CAG repeat number in this individual as well as 33 relatives within the pedigree, including two male carriers of the Kennedy's mutation. The female heterozygote carried one expanded allele of the androgen receptor gene with CAG repeats numbering in the Kennedy's disease range (44 CAGs), with the normal allele numbering in the upper-normal range (28 CAGs). The subject has two sons, one of whom carries the mutant allele of the gene and has been clinically diagnosed with Kennedy's disease, whilst the other son carries the second allele of the gene with CAGs numbering in the upper normal range and displays a normal phenotype. This coexistence of motor neuron disease and the presence of one expanded allele and one allele at the upper limit of the normal range may be a coincidence. However, we hypothesize that the expression of the Kennedy's disease mutation combined with a second allele with a large but normal CAG repeat sequence may have contributed to the motor neuron degeneration displayed in the heterozygote female and discuss the possible reasons for phenotypic expression in particular individuals.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not Set clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998), Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D1GS289, In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The ''repeat expansion detection'' method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

We tested the hypothesis that X-linked genes determining stature which are subject to skewed or non-random X-inactivation can account for discordance in height in monozygotic female twins. Height discordant female monozygotic adult twins (20 pairs) were identified from the Australian Twin Registry, employing the selection criteria of proven monozygosity and a measured height discordance of at least 5 cm. Differential X-inactivation was examined in genomic DNA extracted from peripheral lymphocytes by estimating differential methylation of alleles at the polymorphic CAG triplet repeat of the Androgen receptor gene (XAR). There were 17/20 MZ pairs heterozygous at this locus and informative for analysis. Of these, 10/17 both had random X-inactivation, 5/17 showed identical X-inactivation patterns of non random inactivation and 2/17 (12%) showed discordant X-inactivation. There was no relationship between inactivation patterns and self-report chorionicity. We conclude that non-random X-inactivation does not appear to be a major contributor to intra-pair height discordance in female MZ twins.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The advent of novel biological therapies for the treatment of rheumatic disease has renewed interest in the seronegative spondyloarthropathies (SpAs). International efforts are redefining disease classification and measures of disease activity, outcome, metrology, and imaging. However, opinion is divided between those who propose that the SpA group represents the same disease with variable expression (the lumpers) and those who consider these to be separate diseases with shared clinical features (the splitters). This review presents the evidence for both approaches.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Market-based transmission expansion planning gives information to investors on where is the most cost efficient place to invest and brings benefits to those who invest in this grid. However, both market issue and power system adequacy problems are system planers’ concern. In this paper, a hybrid probabilistic criterion of Expected Economical Loss (EEL) is proposed as an index to evaluate the systems’ overall expected economical losses during system operation in a competitive market. It stands on both investors’ and planner’s point of view and will further improves the traditional reliability cost. By applying EEL, it is possible for system planners to obtain a clear idea regarding the transmission network’s bottleneck and the amount of losses arises from this weak point. Sequentially, it enables planners to assess the worth of providing reliable services. Also, the EEL will contain valuable information for moneymen to undertake their investment. This index could truly reflect the random behaviors of power systems and uncertainties from electricity market. The performance of the EEL index is enhanced by applying Normalized Coefficient of Probability (NCP), so it can be utilized in large real power systems. A numerical example is carried out on IEEE Reliability Test System (RTS), which will show how the EEL can predict the current system bottleneck under future operational conditions and how to use EEL as one of planning objectives to determine future optimal plans. A well-known simulation method, Monte Carlo simulation, is employed to achieve the probabilistic characteristic of electricity market and Genetic Algorithms (GAs) is used as a multi-objective optimization tool.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rupture of a light cellophane diaphragm in an expansion tube has been studied by an optical method. The influence of the light diaphragm on test flow generation has long been recognised, however the diaphragm rupture mechanism is less well known. It has been previously postulated that the diaphragm ruptures around its periphery due to the dynamic pressure loading of the shock wave, with the diaphragm material at some stage being removed from the flow to allow the shock to accelerate to the measured speeds downstream. The images obtained in this series of experiments are the first to show the mechanism of diaphragm rupture and mass removal in an expansion tube. A light diaphragm was impulsively loaded via a shock wave and a series of images was recorded holographically throughout the rupture process, showing gradual destruction of the diaphragm. Features such as the diaphragm material, the interface between gases, and a reflected shock were clearly visualised. Both qualitative and quantitative aspects of the rupture dynamics were derived from the images and compared with existing one-dimensional theory.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Seven cysteine-rich repeats form the ligand-binding region of the low-density lipoprotein (LDL) receptor. Each of these repeats is assumed to bind a calcium ion, which is needed for association of the receptor with its ligands, LDL and beta-VLDL. The effects of metal ions on the folding of the reduced N-terminal cysteine-rich repeat have been examined by using reverse-phase high-performance liquid chromatography to follow the formation of fully oxidized isomers with different disulfide connectivities. in the absence of calcium many of the 15 possible isomers formed on oxidation, whereas in its presence the predominant product at equilibrium had the native disulfide bond connectivities. Other metals were far less effective at directing disulfide bond formation: Mn2+ partly mimicked the action of Ca2+, but Ba2+, Sr2+, and Mg2+ had little effect. This metal-ion specificity was also observed in two-dimensional H-1 NMR spectral studies: only Ca2+ induced the native three-dimensional fold. The two paramagnetic ions, Gd3+ and Mn2+, and Cd2+ did not promote adoption of a well-defined structure, and the two paramagnetic ions did not displace calcium ions. The location of calcium ion binding sites in the repeat was also explored by NMR spectroscopy. The absence of chemical shift changes for the side chain proton resonances of Asp26, Asp36, and Glu37 from pH 3.9 to 6.8 in the presence of calcium ions and their proximal location in the NMR structures implicated these side chains as calcium ligands. Deuterium exchange NMR experiments also revealed a network of hydrogen bonds that stabilizes the putative calcium-binding loop.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Free-piston-driven expansion tubes are capable of generating flaw conditions over a wide range of enthalpies ranging from orbital up to superorbital velocities. Initial optical measurements aimed at investigating the flow in such a facility are presented. Emission studies were used to identify impurities in the how and to investigate spectral regions that are accessible by optical techniques. At moderate enthalpies, it was found that significant radiation resulted from metallic contaminants. At high enthalpies, the spectrum consisted of a number of atomic lines together with a broadband background component indicative of the presence of electrons. The presence of this radiation may limit the applicability of optical techniques that require spectral regions free from the influence of atomic transitions or background radiation. Emission spectroscopy (through Stark broadened hydrogen lines) and two-wavelength holographic interferometry were used to measure the electron number density behind a bow shock on a blunt body at conditions where significant ionization was observed. They yielded average concentrations of (3 +/- 1) x 10(17) cm(-3) from the emission measurements and (3.8 +/- 0.6) x 10(17) cm(-3) from the interferometry.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Structurally related tetratricopeptide repeat motifs in steroid receptor-associated immunophilins and the STI1 homolog, Hop, mediate the interaction with a common cellular target, hsp90, We have identified the binding domain in hsp90 for cyclophilin 40 (CyP40) using a two-hybrid system screen of a mouse cDNA library. All isolated clones encoded the intact carboxyl terminus of hsp90 and overlapped with a common region corresponding to amino acids 558-724 of murine hsp84, The interaction was confirmed in vitro with bacterially expressed CyP40 and deletion mutants of hsp90 beta and was delineated further to a 124-residue COOH-terminal segment of hsp90, Deletion of the conserved MEEVD sequence at the extreme carboxyl terminus of hsp90 precludes interaction with CyP40, signifying an important role for this motif in hsp90 function. We show that CyP40 and Hop display similar interaction profiles with hsp90 truncation mutants and present evidence for the direct competition of Hop and FK506-binding protein 52 with CyP40 for binding to the hsp90 COOH-terminal region. Our results are consistent with a common tetratricopeptide repeat interaction site for Hop and steroid receptor associated immunophilins within a discrete COOH-terminal domain of hsp90. This region of hsp90 mediates ATP-independent chaperone activity, overlaps the hsp90 dimerization domain, and includes structural elements important for steroid receptor interaction.