34 resultados para Rich, Adrienne Cecile , 1929-2012


Relevância:

20.00% 20.00%

Publicador:

Resumo:

School renewal', 'productive pedagogies', 'rich tasks', 'New Basics', 'key learning areas'--these are some of the discourses of change in selected Queensland schools. This paper will report on teaching as an insider/outsider in a school's Health and Physical Education department during a time of intense pressure for structural, curriculum and pedagogical shifts. As a teacher/researcher, I spent ten weeks in a government secondary school attempting to implement rich tasks as well as collect data using formal and informal interviews, field note, and document analyses, with a focus upon teachers', students' and administrators' sense of change processes and outcomes. It is suggested that the processes of, and barriers to, curriculum change in this context are best explained in terms of tensions between modernist and postmodernist phenomena.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Seven cysteine-rich repeats form the ligand-binding region of the low-density lipoprotein (LDL) receptor. Each of these repeats is assumed to bind a calcium ion, which is needed for association of the receptor with its ligands, LDL and beta-VLDL. The effects of metal ions on the folding of the reduced N-terminal cysteine-rich repeat have been examined by using reverse-phase high-performance liquid chromatography to follow the formation of fully oxidized isomers with different disulfide connectivities. in the absence of calcium many of the 15 possible isomers formed on oxidation, whereas in its presence the predominant product at equilibrium had the native disulfide bond connectivities. Other metals were far less effective at directing disulfide bond formation: Mn2+ partly mimicked the action of Ca2+, but Ba2+, Sr2+, and Mg2+ had little effect. This metal-ion specificity was also observed in two-dimensional H-1 NMR spectral studies: only Ca2+ induced the native three-dimensional fold. The two paramagnetic ions, Gd3+ and Mn2+, and Cd2+ did not promote adoption of a well-defined structure, and the two paramagnetic ions did not displace calcium ions. The location of calcium ion binding sites in the repeat was also explored by NMR spectroscopy. The absence of chemical shift changes for the side chain proton resonances of Asp26, Asp36, and Glu37 from pH 3.9 to 6.8 in the presence of calcium ions and their proximal location in the NMR structures implicated these side chains as calcium ligands. Deuterium exchange NMR experiments also revealed a network of hydrogen bonds that stabilizes the putative calcium-binding loop.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The testing of a 30-mer dG-rich phosphorothioate oligodeoxynucleotide (LG4PS) for effects on the behaviour of vascular smooth muscle cells (VSMC) in vitro and in vivo is described. LG4PS at 0.3 mu M inhibited significantly the phenotype modulation of freshly isolated rabbit VSMC, and cell outgrowth from pig aortic explants was inhibited similar to 80% by 5 mu M LG4PS. The growth of proliferating rabbit and pig VSMC was inhibited similar to 70% by 0.3 mu M and 5 mu M LG4PS, respectively. Though less marked, the antiproliferative effects of LG4PS on human VSMC were comparable to those obtained with heparin. The cytotoxic effects of LG4PS on VSMC in vitro were low. Despite these promising results, adventitial application of 2-200 nmol LG4PS in pluronic gel failed to reduce vascular hyperplasia in balloon-injured rabbit carotid arteries, and the highest dose caused extensive mortality. (C) 1997 Academic Press Limited.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

NMR is a powerful technique for determining structures of biologically active molecules in solution. In recent years. our laboratory has focussed on the structure determination of small disulfide-rich proteins from both plants and animals which are valuable targets in drug design applications. This article will review these structural studies and their implications in drug design.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Las Campanas Observatory and Anglo-Australian Telescope Rich Cluster Survey (LARCS) is a panoramic imaging and spectroscopic survey of an X-ray luminosity-selected sample of 21 clusters of galaxies at 0.07 < z < 0.16. Charge-coupled device (CCD) imaging was obtained in B and R of typically 2 degrees wide regions centred on the 21 clusters, and the galaxy sample selected from the imaging is being used for an on-going spectroscopic survey of the clusters with the 2dF spectrograph on the Anglo-Australian Telescope. This paper presents the reduction of the imaging data and the photometric analysis used in the survey. Based on an overlapping area of 12.3 deg(2) we compare the CCD-based LARCS catalogue with the photographic-based galaxy catalogue used for the input to the 2dF Galaxy Redshift Survey (2dFGRS) from the APM, to the completeness of the GRS/APM catalogue, b(J) = 19.45. This comparison confirms the reliability of the photometry across our mosaics and between the clusters in our survey. This comparison also provides useful information concerning the properties of the GRS/APM. The stellar contamination in the GRS/APM galaxy catalogue is confirmed as around 5-10 per cent, as originally estimated. However, using the superior sensitivity and spatial resolution in the LARCS survey evidence is found for four distinct populations of galaxies that are systematically omitted from the GRS/APM catalogue. The characteristics of the 'missing' galaxy populations are described, reasons for their absence examined and the impact they will have on the conclusions drawn from the 2dF Galaxy Redshift Survey are discussed.

Relevância:

20.00% 20.00%

Publicador:

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present a photometric investigation of the variation in galaxy colour with environment in 11 X-ray-luminous clusters at 0.07 less than or equal to z less than or equal to 0.16 taken from the Las Campanas/AAT Rich Cluster Survey. We study the properties of the galaxy populations in individual clusters, and take advantage of the homogeneity of the sample to combine the clusters together to investigate weaker trends in the composite sample. We find that modal colours of galaxies lying on the colour-magnitude relation in the clusters become bluer by d(B - R)/dr(p) = -0.022 +/- 0.004 from the cluster core out to a projected radius of r(p) = 6 Mpc, further out in radius than any previous study. We also examine the variation in modal galaxy colour with local galaxy density, 2, for galaxies lying close to the colour-magnitude relation, and find that the median colour shifts bluewards by d(B - R)/d log(10)(Sigma) = -0.076 +/- 0.009 with decreasing local density across three orders of magnitude. We show that the position of the red envelope of galaxies in the colour-magnitude relation does not vary as a function of projected radius or density within the clusters, suggesting that the change in the modal colour results from an increasing fraction of bluer galaxies within the colour-magnitude relation, rather than a change in the colours of the whole population. We show that this shift in the colour-magnitude relations with projected radius and local density is greater than that expected from the changing morphological mix based on the local morphology-density relation. We therefore conclude that we are seeing a real change in the properties of galaxies on the colour-magnitude relation in the outskirts of clusters. The simplest interpretation of this result (and similar constraints in local clusters) is that an increasing fraction of galaxies in the lower density regions at large radii within clusters exhibit signatures of star formation in the recent past, signatures which are not seen in the evolved galaxies in the highest density regions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Geospatial clustering must be designed in such a way that it takes into account the special features of geoinformation and the peculiar nature of geographical environments in order to successfully derive geospatially interesting global concentrations and localized excesses. This paper examines families of geospaital clustering recently proposed in the data mining community and identifies several features and issues especially important to geospatial clustering in data-rich environments.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Stickiness is a major reason that limits the spray drying of various sugar-rich food products. Higher hygroscopicity of amorphous powder, increase in solubility of sugars with temperature, and lower melting point and glass transition temperature, contribute to the stickiness problem. So far, the glass transition temperature has been widely accepted as a best indicator for stickiness. There are various manoeuvres that have been applied to spray dry such products. Some of them are the addition of drying aids, modification of drier design and use of mild drying temperature conditions. This review paper highlights the major research works that deal with the stickiness property of sugar-rich foods.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A semi-empirical linear equation has been developed to optimise the amount of maltodextrin additive (DE 6) required to successfully spray dry a sugar-rich product on the basis of its composition. Based on spray drying experiments, drying index values for individual sugars (sucrose, glucose, frutose) and citric acid were determined, and us;ng these index values an equation for model mixtures of these components was established. This equation has been tested with two sugar-rich natural products, pineapple juice and honey. The relationship was found to be valid for these products.