113 resultados para Repeat moves
Resumo:
Seven cysteine-rich repeats form the ligand-binding region of the low-density lipoprotein (LDL) receptor. Each of these repeats is assumed to bind a calcium ion, which is needed for association of the receptor with its ligands, LDL and beta-VLDL. The effects of metal ions on the folding of the reduced N-terminal cysteine-rich repeat have been examined by using reverse-phase high-performance liquid chromatography to follow the formation of fully oxidized isomers with different disulfide connectivities. in the absence of calcium many of the 15 possible isomers formed on oxidation, whereas in its presence the predominant product at equilibrium had the native disulfide bond connectivities. Other metals were far less effective at directing disulfide bond formation: Mn2+ partly mimicked the action of Ca2+, but Ba2+, Sr2+, and Mg2+ had little effect. This metal-ion specificity was also observed in two-dimensional H-1 NMR spectral studies: only Ca2+ induced the native three-dimensional fold. The two paramagnetic ions, Gd3+ and Mn2+, and Cd2+ did not promote adoption of a well-defined structure, and the two paramagnetic ions did not displace calcium ions. The location of calcium ion binding sites in the repeat was also explored by NMR spectroscopy. The absence of chemical shift changes for the side chain proton resonances of Asp26, Asp36, and Glu37 from pH 3.9 to 6.8 in the presence of calcium ions and their proximal location in the NMR structures implicated these side chains as calcium ligands. Deuterium exchange NMR experiments also revealed a network of hydrogen bonds that stabilizes the putative calcium-binding loop.
Resumo:
A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.
Resumo:
Structurally related tetratricopeptide repeat motifs in steroid receptor-associated immunophilins and the STI1 homolog, Hop, mediate the interaction with a common cellular target, hsp90, We have identified the binding domain in hsp90 for cyclophilin 40 (CyP40) using a two-hybrid system screen of a mouse cDNA library. All isolated clones encoded the intact carboxyl terminus of hsp90 and overlapped with a common region corresponding to amino acids 558-724 of murine hsp84, The interaction was confirmed in vitro with bacterially expressed CyP40 and deletion mutants of hsp90 beta and was delineated further to a 124-residue COOH-terminal segment of hsp90, Deletion of the conserved MEEVD sequence at the extreme carboxyl terminus of hsp90 precludes interaction with CyP40, signifying an important role for this motif in hsp90 function. We show that CyP40 and Hop display similar interaction profiles with hsp90 truncation mutants and present evidence for the direct competition of Hop and FK506-binding protein 52 with CyP40 for binding to the hsp90 COOH-terminal region. Our results are consistent with a common tetratricopeptide repeat interaction site for Hop and steroid receptor associated immunophilins within a discrete COOH-terminal domain of hsp90. This region of hsp90 mediates ATP-independent chaperone activity, overlaps the hsp90 dimerization domain, and includes structural elements important for steroid receptor interaction.
Resumo:
Background: The ornamental tobacco Nicotiana alata produces a series of proteinase inhibitors (Pls) that are derived from a 43 kDa precursor protein, NaProPl. NaProPl contains six highly homologous repeats that fold to generate six separate structural domains, each corresponding to one of the native Pls. An unusual feature of NaProPl is that the structural domains lie across adjacent repeats and that the sixth Pl domain is generated from fragments of the first and sixth repeats. Although the homology of the repeats suggests that they may have arisen from gene duplication, the observed folding does not appear to support this. This study of the solution structure of a single NaProPl repeat (aPl1) forms a basis for unravelling the mechanism by which this protein may have evolved, Results: The three-dimensional structure of aPl1 closely resembles the triple-stranded antiparallel beta sheet observed in each of the native Pls. The five-residue sequence Glu-Glu-Lys-Lys-Asn, which forms the linker between the six structural domains in NaProPl, exists as a disordered loop in aPl1. The presence of this loop in aPl1 results in a loss of the characteristically flat and disc-like topography of the native inhibitors. Conclusions: A single repeat from NaProPl is capable of folding into a compact globular domain that displays native-like Pl activity. Consequently, it is possible that a similar single-domain inhibitor represents the ancestral protein from which NaProPl evolved.
Resumo:
Recent reports have shown neurodegenerative disorders to be associated with abnormal expansions of a CAG trinucleotide repeat allele at various autosomal loci. While normal chromosomes have 14 to 44 repeats, disease chromosomes may have 60 to 84 repeats. The number of CAG repeats on mutant chromosomes correlates with increasing severity of disease or decreasing age at onset of symptoms. Since we are interested in identifying the many quantitative trait loci (QTL) influencing brain functioning, we examined the possibility that the number of CAG repeats in the normal size range at these loci are relevant to "normal" neural functioning. We have used 150 pairs of adolescent (aged 16 years) twins and their parents to examine allele size at the MJD, SCA1, and DRPLA loci in heterozygous normal individuals. These are part of a large ongoing project using cognitive and physiological measures to investigate the genetie influences on cognition, and an extensive protocol of tests is employed to assess some of the key components of intellectual functioning. This study selected to examine full-scale psychometric IQ (FSIQ) and a measure of information processing (choice reaction time) and working memory (slow wave amplitude). CAG repeat size was determined on an ABI Genescan system following multiplex PCR amplification. Quantitative genetic analyses were performed to determine QTL effects of MJD, SCA1, and DRPLA on cognitive functioning. Analyses are in progress and will be discussed.
Resumo:
Fragile sites appear visually as nonstaining gaps on chromosomes that are inducible by specific cell culture conditions. Expansion of CGG/ CCG repeats has been shown to be the molecular basis of all five folate-sensitive fragile sites characterized molecularly so far, i.e., FRAXA, FRAXE, FRAXF, FRA11B, and FRA16A. In the present study we have refined the localization of the FRA10A folate-sensitive fragile site by fluorescence in situ hybridization. Sequence analysis of a BAC clone spanning FRA10A identified a single, imperfect, but polymorphic CGG repeat that is part of a CpG island in the 5'UTR of a novel gene named FRA10ACl. The number of CGG repeats varied in the population from 8 to 13. Expansions exceeding 200 repeat units were methylated in all FRA10A fragile site carriers tested. The FRA10ACl gene consists of 19 exons and is transcribed in the centromeric direction from the FRA10A repeat. The major transcript of similar to 1450 nt is ubiquitously expressed and codes for a highly conserved protein, FRA10ACl, of unknown function. Several splice variants leading to alternative 3' ends were identified (particularly in testis). These give rise to FRA10ACl proteins with altered COOH-termini. Immunofluorescence analysis of full-length, recombinant EGFP-tagged FRA10ACl protein showed that it was present exclusively in the nucleoplasm. We show that the expression of FRA10A, in parallel to the other cloned folate-sensitive fragile sites, is caused by an expansion and subsequent methylation of an unstable CGG trinucleotide repeat. Taking advantage of three cSNPs within the FRA10ACl gene we demonstrate that one allele of the gene is not transcribed in a FRA10A carrier. Our data also suggest that in the heterozygous state FRA10A is likely a benign folate-sensitive fragile site. (C) 2004 Elsevier Inc. All rights reserved.
Resumo:
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Resumo:
The SH3 domains of src and other nonreceptor tyrosine kinases have been shown to associate with the motif PXXP, where P and X stand for proline and an unspecified amino acid, but a motif that binds to the SH3 domain of myosin has thus far not been characterized. We previously showed that the SH3 domain of Acanthamoeba myosin-IC interacts with the protein Acan125. We now report that the Acan125 protein sequence contains two tandem consensus PXXP motifs near the C terminus. To test for binding, we expressed a polypeptide, AD3p, which includes 344 residues of native C-terminal sequence and a mutant polypeptide, AD3 Delta 977-994p, which lacks the sequence RPKPVPPPRGAKPAPPPR containing both PXXP motifs. The SH3 domain of Acanthamoeba myosin-IC bound AD3p and not AD3 Delta 977-994p, showing that the PXXP motifs are required for SH3 binding. The sequence of Acan125 is related overall to a protein of unknown function coded by Caenorhabditis elegans gene K07G5.1. The K07G5.1 gene product contains a proline-rich segment similar to the SH3 binding motif found in Acan125. The aligned sequences show considerable conservation of leucines and other hydrophobic residues, including the spacing of these residues, which matches a motif for leucine-rich repeats (LRRs). LRR domains have been demonstrated to be sites for ligand binding. Having an LRR domain and an SH3-binding domain, Acan125 and the C. elegans homologue define a novel family of bifunctional binding proteins.
Resumo:
Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.
Resumo:
Leucine-rich repeats (LRRs) are 20-29-residue sequence motifs present in a number of proteins with diverse functions. The primary function of these motifs appears to be to provide a versatile structural framework for the formation of protein-protein interactions. The past two years have seen an explosion of new structural information on proteins with LRRs. The new structures represent different LRR subfamilies and proteins with diverse functions, including GTPase-activating protein rna 1 p from the ribonuclease-inhibitor-like subfamily; spliceosomal protein U2A', Rab geranylgeranyltransferase, internalin B, dynein light chain 1 and nuclear export protein TAP from the SDS22-like subfamily; Skp2 from the cysteine-containing subfamily; and YopM from the bacterial subfamily. The new structural information has increased our understanding of the structural determinants of LRR proteins and our ability to model such proteins with unknown structures, and has shed new light on how these proteins participate in protein-protein interactions.
Resumo:
Epstein-Barr virus (EBV)-encoded nuclear antigen 1 (EBNA1) includes a unique glycine-alanine repeat domain that inhibits the endogenous presentation of cytotoxic T lymphocyte (CTL) epitopes through the class I pathway by blocking proteasome-dependent degradation of this antigen. This immune evasion mechanism has been implicated in the pathogenesis of EBV-associated diseases. Here, we show that cotranslational ubiquitination combined with N-end rule targeting enhances the intracellular degradation of EBNA1, thus resulting in a dramatic reduction in the half-life of the antigen. Using DNA expression vectors encoding different forms of ubiquitinated EBNA1 for in vivo studies revealed that this rapid degradation, remarkably, leads to induction of a very strong CTL response to an EBNA1-specific CTL epitope. Furthermore, this targeting also restored the endogenous processing of HLA class I-restricted CTL epitopes within EBNA1 for immune recognition by human EBV-specific CTLs. These observations provide, for the first time, evidence that the glycine-alanine repeat-mediated proteasomal block on EBNA1 can be reversed by specifically targeting this antigen for rapid degradation resulting in enhanced CD8+ T cell-mediated recognition in vitro and in vivo.
Resumo:
We characterized the consensus sequence and structure of a long terminal repeat (LTR) retrotransposon from the genome of the human blood fluke, Schistosoma japonicum, and have earned this element, Gulliver. The full length, consensus Gulliver LTR retrotransposon was 4788 bp, and it was flanked at its 5'- and 3'-ends by LTRs of 259 bp. Each LTR included RNA polymerase II promoter sequences, a CAAT signal and a TATA box, Gulliver exhibited features characteristic of a functional LTR retrotransposon including two read through (termination) ORFs encoding retroviral gag and pol proteins of 312 and 1071 amino acid residues, respectively. The gag ORF encoded motifs conserved in nucleic acid binding proteins, while the pol ORF encoded conserved domains of aspartic protease, reverse transcriptase (RT), RNaseH and integrase, in that order, a pol pattern conserved in the gypsy lineage of LTR retrotransposons. Whereas the sequence and structure of Gulliver was similar to that of gypsy, phylogenetic analysis revealed that Gulliver did not group particularly closely with the gypsy family. Rather, its closest relatives were a LTR retrotransposon from Caenorhabditis elegans, mag from Bombyx mori and, to a lesser extent, easel from the salmon Oncorhynchus keta. Dot blot hybridizations indicated that Gulliver was present at between 100 and several thousand copies in the S. japonicum genome, and Southern hybridization analysis suggested its probable presence in the genome of Schistosoma mansoni. Transcripts encoding the RT domain of Gulliver were detected by RT-PCR in larval and adult stages of S. japonicum, indicating that (at least) the RT domain of Gulliver is transcribed. This is the first report of the sequence and structure of an LTR retrotransposon from any schistosome or indeed from any species belonging to the phylum Platyhelminthes. (C) 2001 Elsevier Science B.V. All rights reserved.