60 resultados para Dinucleotide Repeat Polymorphism


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Type 1 diabetes (T1D) is a multifactorial autoimmune disease, with strong genetic component. Several susceptibility loci contribute to genetic predisposition to T1D. One of these loci have been mapped to chromosome 1q42 in UK and US joined affected family data sets but needs to be replicated in other populations. In this study, we evaluated sixteen microsatellites located on 1q42 for linkage with T1D in 97 Russian affected sibling pairs. A 2.7-cm region of suggestive linkage to T1D between markers D1S1644 and D1S225 was found by multipoint linkage analysis. The peak of linkage was shown for D1S2847 (P = 0.0005). Transmission disequilibrium test showed significant undertransmission of the 156-bp allele of D1S2847 from parents to diabetic children (28 transmissions vs. 68 nontransmissions, P = 0.043) in Russian affected families. A preferential transmission from parents to diabetic offspring was also shown for the T(-25) and T1362 alleles of the C/T(-25) and C/T1362 dimorphisms, both located at the TAF5L gene, which is situated 103 kb from D1S2847. Together with the A/C744 TAF5L SNP, these markers share common T(-25)/A744/T1362 and C(-25)/C744/T1362 haplotypes associated with higher and lower risk of diabetes (Odds Ratio = 2.15 and 0.62, respectively). Our results suggest that the TAF5L gene, encoding TAF5L-like RNA polymerase II p300/CBP associated factor (PCAF)-associated factor, could represent the susceptibility gene for T1D on chromosome 1q42 in Russian affected patients.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

DNA mismatch repair is an important mechanism involved in maintaining the fidelity of genomic DNA. Defective DNA mismatch repair is implicated in a variety of gastrointestinal and other turners; however, its role in hepatocellular carcinoma (HCC) has not been assessed. Formalin-fixed, paraffin-embedded archival pathology tissues from 46 primary liver tumors were studied by microdissection and microsatellite analysis of extracted DNA to assess the degree of microsatellite instability, a marker of defective mismatch repair, and to determine the extent and timing of allelic loss of two DNA mismatch repair genes, human Mut S homologue-2 (hMSH2) and human Mut L homologue-1 (hMLH1), and the tumor suppressor genes adenomatous polyposis coli gene (APC), p53, and DPC4. Microsatellite instability was detected in 16 of the tumors (34.8%). Loss of heterozygosity at microsatellites linked to the DNA mismatch repair genes, hMSH2 and/or hMLH1, was found in 9 cases (19.6%), usually in association with microsatellite instability. Importantly, the pattern of allelic loss was uniform in 8 of these 9 tumors, suggesting that clonal loss had occurred. Moreover, loss at these loci also occurred in nonmalignant tissue adjacent to 4 of these tumors, where it was associated with marked allelic heterogeneity. There was relatively infrequent loss of APC, p53, or DPC4 loci that appeared unrelated to loss of hMSH2 or hMLH1 gene loci. Loss of heterozygosity at hMSH2 and/or hMLH1 gene loci, and the associated microsatellite instability in premalignant hepatic tissues suggests a possible causal role in hepatic carcinogenesis in a subset of hepatomas.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

We have previously isolated and characterized murine MYB binding protein (p160) 1a, a protein that specifically interacts with the leucine zipper motif within the negative regulatory domain of the c-Myb proto-oncoprotein, We now describe the molecular cloning of the human MYBBP1A cDNA and chromosomal localization to 17p13.3 by fluorescence in situ hybridization analysis, Given the likely presence of a tumor suppressor gene (or genes) within this region of chromosome 17, the position of MYBBP1A was further mapped by radiation hybrid analysis and was found to lie between markers D17S1828 and D17S938. A P1 artificial chromosome clone containing the 5' region of MYBBP1A was isolated and indicates a physical linkage between MYBBP1A and the 15-lipoxygenase gene (ALOX15), A novel, polymorphic (CA)(25) dinucleotide repeat was also isolated from this PAC and may serve as a useful marker for MYBBP1A and this region of chromosome 17. (C) 1999 Academic Press.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

GABAergic systems have been implicated in the pathogenesis of anxiety, depression and insomnia. These symptoms are part of the core and comorbid psychiatric disturbances in post-traumatic stress disorder (PTSD) In a sample of Caucasian male PTSD patients, dinucleotide repeat polymorphisms of the GABAA receptor beta3 subunit gene were compared to scores on the General Health Questionnaire-28 (GHQ). As the major allele at this gene locus (GABRB3) was GI, the alleles were divided into GI and non-GI groups. On the total score of the GHQ, which comprises the somatic symptoms, anxiety/insomnia, social dysfunction and depression subscales, patients with the GI non-GI genotype had a significantly higher score when compared to either the G1G1 genotype (alpha = 0.01) or the non-GI non-GI genotype (alpha = 0.05). No significant difference was found between the G1G1 and non-Gl non-G1 genotypes. When the GI non-G1 heterozygotes were compared to the combined G1G1 and non-GI non-GI homozygotes, a significantly higher total GHQ score was found in the heterozygotes (P = 0.002). These observations suggest a heterosis effect. Further analysis of GHQ subscale scores showed that heterozygotes compared to the combined homozygotes had higher scores on the somatic symptoms (P = 0.006), anxiety/insomnia (P = 0.003), social dysfunction (P = 0.054) and depression (P = 0.004) subscales. In conclusion, the present study indicates that in a population of PTSD patients, heterozygosity of the GABRB3 major (GI) allele confers higher levels of somatic symptoms, anxiety/insomnia, social dysfunction and depression than found in homozygosity. (C) 2001 Elsevier Science Ireland Ltd. All rights reserved.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The interaction between genetic and environmental factors for PD was examined in a Chinese population. It was found that although the intron 2 MAOB (GT)(n) repeat polymorphism was not associated with PID in the population, a relationship might have been masked by the protective effect of tea drinking. In individuals who did not drink tea (<1 cup/day), the possession of short length less than or equal to 178 bp (GT), alleles conferred a borderline significant increased risk for PD (adjusted OR = 1.47; C.l. = 1.03-2. 1). As the extent of tea consumption increased, the association between the less than or equal to178 bp allele and PD disappeared. This result suggests that the MAOB gene may be associated with PD in Chinese if the putative protective effect of tea drinking is taken into account. The significance of this finding is unclear as the study may be limited because of its marginal significance and limited numbers. However, it does demonstrate the importance of considering putative positive and negative environmental risk factors in any examination of genetic risk factors for PD. (C) 2003 Elsevier Science Ltd. All rights reserved.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The dopamine D4 receptor gene contains a polymorphic sequence consisting of a variable number of 48-base-pair (bp) repeats, and there have been a number of reports that this polymorphism is associated with variation in novelty seeking or in substance abuse and addictive behaviors. In this study we have assessed the linkage and association of DRD4 genotype with novelty seeking, alcohol use, and smoking in a sample of 377 dizygotic twin pairs and 15 single twins recruited from the Australian Twin Registry (ATR). We found no evidence of linkage or association of the DRD4 locus with any of the phenotypes. We made use of repeated measures for some phenotypes to increase power by multivariate genetic analysis, but allelic effects were still non-significant. Specifically, it has been suggested that the DRD4 7-repeat allele is associated with increased novelty seeking in males but we found no evidence for this, despite considerable power to do so. We conclude that DRD4 variation does not have an effect on use of alcohol and the problems that arise from it, on smoking, or on novelty seeking behavior. (C) 2003 Wiley-Liss, Inc.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

The advent of novel biological therapies for the treatment of rheumatic disease has renewed interest in the seronegative spondyloarthropathies (SpAs). International efforts are redefining disease classification and measures of disease activity, outcome, metrology, and imaging. However, opinion is divided between those who propose that the SpA group represents the same disease with variable expression (the lumpers) and those who consider these to be separate diseases with shared clinical features (the splitters). This review presents the evidence for both approaches.

Relevância:

80.00% 80.00%

Publicador:

Resumo:

We report the clinical characteristics of a schizophrenia sample of 409 pedigrees-263 of European ancestry ( EA) and 146 of African American ancestry ( AA)-together with the results of a genome scan ( with a simple tandem repeat polymorphism interval of 9 cM) and follow-up fine mapping. A family was required to have a proband with schizophrenia ( SZ) and one or more siblings of the proband with SZ or schizoaffective disorder. Linkage analyses included 403 independent full-sibling affected sibling pairs ( ASPs) ( 279 EA and 124 AA) and 100 all-possible half-sibling ASPs ( 15 EA and 85 AA). Nonparametric multipoint linkage analysis of all families detected two regions with suggestive evidence of linkage at 8p23.3-q12 and 11p11.2-q22.3 ( empirical Z likelihood-ratio score [ Z(lr)] threshold >= 2.65) and, in exploratory analyses, two other regions at 4p16.1-p15.32 in AA families and at 5p14.3-q11.2 in EA families. The most significant linkage peak was in chromosome 8p; its signal was mainly driven by the EA families. Z(lr) scores >= 2.0 in 8p were observed from 30.7 cM to 61.7 cM ( Center for Inherited Disease Research map locations). The maximum evidence in the full sample was a multipoint Z(lr) of 3.25 ( equivalent Kong-Cox LOD of 2.30) near D8S1771 ( at 52 cM); there appeared to be two peaks, both telomeric to neuregulin 1 ( NRG1). There is a paracentric inversion common in EA individuals within this region, the effect of which on the linkage evidence remains unknown in this and in other previously analyzed samples. Fine mapping of 8p did not significantly alter the significance or length of the peak. We also performed fine mapping of 4p16.3-p15.2, 5p15.2-q13.3, 10p15.3-p14, 10q25.3-q26.3, and 11p13-q23.3. The highest increase in Z(lr) scores was observed for 5p14.1-q12.1, where the maximum Z(lr) increased from 2.77 initially to 3.80 after fine mapping in the EA families.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich similar to 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded similar to 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Microsatellites or simple sequence repeats (SSRs) are ubiquitous in eukaryotic genomes. Single-locus SSR markers have been developed for a number of species, although there is a major bottleneck in developing SSR markers whereby flanking sequences must be known to design 5'-anchors for polymerase chain reaction (PCR) primers. Inter SSR (ISSR) fingerprinting was developed such that no sequence knowledge was required. Primers based on a repeat sequence, such as (CA)(n), can be made with a degenerate 3'-anchor, such as (CA)(8)RG or (AGC)(6)TY. The resultant PCR reaction amplifies the sequence between two SSRs, yielding a multilocus marker system useful for fingerprinting, diversity analysis and genome mapping. PCR products are radiolabelled with P-32 or P-33 via end-labelling or PCR incorporation, and separated on a polyacrylamide sequencing gel prior to autoradiographic visualisation. A typical reaction yields 20-100 bands per lane depending on the species and primer. We have used ISSR fingerprinting in a number of plant species, and report here some results on two important tropical species, sorghum and banana. Previous investigators have demonstrated that ISSR analysis usually detects a higher level of polymorphism than that detected with restriction fragment length polymorphism (RFLP) or random amplified polymorphic DNA (RAPD) analyses. Our data indicate that this is not a result of greater polymorphism genetically, but rather technical reasons related to the detection methodology used for ISSR analysis.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

RAD51 colocalizes with both BRCA1 and BRCA2, and genetic variants in RAD51 would be candidate BRCA1/2 modifiers. We searched for RAD51 polymorphisms by sequencing 20 individuals. We compared the polymorphism allele frequencies between female BRCA1/2 mutation carriers with and without breast or ovarian cancer and between population-based ovarian cancer cases with BRCA1/2 mutations to cases and controls without mutations. We discovered two single nucleotide polymorphisms (SNPs) at positions 135 g-->c and 172 g-->t of the 5' untranslated region. In an initial group of BRCA1/2 mutation carriers, 14 (21%) of 67 breast cancer cases carried a c allele at RAD51:135 g-->c, whereas 8 (7%) of 119 women without breast cancer carried this allele. In a second set of 466 mutation carriers from three centers, the association of RAD51:135 g-->c with breast cancer risk was not confirmed. Analyses restricted to the 216 BRCA2 mutation carriers, however, showed a statistically significant association of the 135 c allele with the risk of breast cancer (adjusted odds ratio, 3.2; 95% confidence limit, 1.4-40). BRCA1/2 mutation carriers with ovarian cancer were only about one half as likely to carry the RAD51:135 g-->c SNP. Analysis of the RAD51:135 g-->c SNP in 738 subjects from an Israeli ovarian cancer case-control study was consistent with a lower risk of ovarian cancer among BRCA1/2 mutation carriers with the c allele. We have identified a RAD51 5' untranslated region SNP that may be associated with an increased risk of breast cancer and a lower risk of ovarian cancer among BRCA2 mutation carriers. The biochemical basis of this risk modifier is currently unknown.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The complete sequence of the MCIR locus has been assembled, the coding region of the gene is intronless and placed within a 12 kb region flanked by the NULP1 and TUBB4 genes. The immediate promoter region has an E-box site with homology to the M-box consensus known to bind the microphthalmia transcription factor (MITF), however, promoter deletion analysis and transactivation studies have failed to show activation through this element by MITF. Polymorphism within the coding region, immediate 5' promoter region and a variable number tandem repeat (VNTR) minisatellite within the locus have been examined in a collection of Caucasian families and African individuals. Haplotype analysis shows linkage disequilibrium between the VNTR and MCIR coding region red hair variant alleles which can be used to estimate the age of these missense changes. Assuming a mean VNTR mutation rate of 1% and a star phylogeny, we estimate the Arg151Cys variant arose 7500 years before the present day, suggesting these variants may have arisen in the Caucasian population more recently than previously thought. (C) 2001 Published by Elsevier Science B.V.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Sixty-nine intestinal spirochetes isolated from pigs and poultry in eastern Australia were selected to evaluate the effectiveness of a species-specific PCR-based restriction fragment length polymorphism (RFLP) analysis of the Brachyspira nox gene. For comparative purposes, all isolates were subjected to species-specific PCRs for the pathogenic species Brachyspira hyodysenteriae and Brachyspira pilosicoli, and selected isolates were examined further by sequence analysis of the nox and 16S ribosomal RNA genes. Modifications to the original nox-RFLP method included direct inoculation of bacterial cells into the amplification mixture and purification of the PCR product, which further optimized the nox-RFLP for use in a veterinary diagnostic laboratory, producing sufficient product for both species identification and future comparisons. Although some novel profiles that prevented definitive identification were observed, the nox-RFLP method successfully classified 45 of 51 (88%) porcine and 15 of 18 (83%) avian isolates into 5 of the 6 recognized species of Brachyspira. This protocol represents a significant improvement over conventional methods currently used in veterinary diagnostic laboratories for rapid specific identification of Brachyspira spp. isolated from both pigs and poultry.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Seven cysteine-rich repeats form the ligand-binding region of the low-density lipoprotein (LDL) receptor. Each of these repeats is assumed to bind a calcium ion, which is needed for association of the receptor with its ligands, LDL and beta-VLDL. The effects of metal ions on the folding of the reduced N-terminal cysteine-rich repeat have been examined by using reverse-phase high-performance liquid chromatography to follow the formation of fully oxidized isomers with different disulfide connectivities. in the absence of calcium many of the 15 possible isomers formed on oxidation, whereas in its presence the predominant product at equilibrium had the native disulfide bond connectivities. Other metals were far less effective at directing disulfide bond formation: Mn2+ partly mimicked the action of Ca2+, but Ba2+, Sr2+, and Mg2+ had little effect. This metal-ion specificity was also observed in two-dimensional H-1 NMR spectral studies: only Ca2+ induced the native three-dimensional fold. The two paramagnetic ions, Gd3+ and Mn2+, and Cd2+ did not promote adoption of a well-defined structure, and the two paramagnetic ions did not displace calcium ions. The location of calcium ion binding sites in the repeat was also explored by NMR spectroscopy. The absence of chemical shift changes for the side chain proton resonances of Asp26, Asp36, and Glu37 from pH 3.9 to 6.8 in the presence of calcium ions and their proximal location in the NMR structures implicated these side chains as calcium ligands. Deuterium exchange NMR experiments also revealed a network of hydrogen bonds that stabilizes the putative calcium-binding loop.