35 resultados para Chromosomes, human, pair 21


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The hypothesis of the existence of one or more schizophrenia susceptibility loci on chromosome 22q is supported by reports of genetic linkage and association, meta-analyses of linkage, and the observation of elevated risk for psychosis in people with velocardiofacial syndrome, caused by 22q11 microdeletions. We tested this hypothesis by evaluating 10 microsatellite markers spanning 22q in a multicenter sample of 779 pedigrees. We also incorporated age at onset and sex into the analysis as covariates. No significant evidence for linkage to schizophrenia or for linkage associated with earlier age at onset, gender, or heterogeneity across sites was observed. We interpret these findings to mean that the population-wide effects of putative 22q schizophrenia susceptibility loci are too weak to detect with linkage analysis even in large samples.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

There are 481 segments longer than 200 base pairs (bp) that are absolutely conserved (100% identity with no insertions or deletions) between orthologous regions of the human, rat, and mouse genomes. Nearly all of these segments are also conserved in the chicken and dog genomes, with an average of 95 and 99% identity, respectively. Many are also significantly conserved in fish. These ultraconserved elements of the human genome are most often located either overlapping exons in genes involved in RNA processing or in introns or nearby genes involved in the regulation of transcription and development. Along with more than 5000 sequences of over 100 bp that are absolutely conserved among the three sequenced mammals, these represent a class of genetic elements whose functions and evolutionary origins are yet to be determined, but which are more highly conserved between these species than are proteins and appear to be essential for the ontogeny of mammals and other vertebrates.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The mammalian transcriptome contains many nonprotein-coding RNAs (ncRNAs), but most of these are of unclear significance and lack strong sequence conservation, prompting suggestions that they might be non-functional. However, certain long functional ncRNAs such as Air and Xist are also poorly conserved. In this article, we systematically analyzed the conservation of several groups of functional ncRNAs, including miRNAs, snoRNAs and longer ncRNAs whose function has been either documented or confidently predicted. As expected, miRNAs and snoRNAs were highly conserved. By contrast, the longer functional non-micro, non-sno ncRNAs were much less conserved with many displaying rapid sequence evolution. Our findings suggest that longer ncRNAs are under the influence of different evolutionary constraints and that the lack of conservation displayed by the thousands of candidate ncRNAs does not necessarily signify an absence of function.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Objective: To improve the success of culturing olfactory neurons from human nasal mucosa by investigating the intranasal distribution of the olfactory epithelium and devising new techniques for growing human olfactory epithelium in vitro. Design: Ninety-seven biopsy specimens were obtained from 33 individuals, aged 21 to 74 years, collected from 6 regions of the nasal cavity. Each biopsy specimen was bisected, and 1 piece was processed for immunohistochemistry or electron microscopy while the other piece was dissected further for explant culture. Four culture techniques were performed, including whole explants and explanted biopsy slices. Five days after plating, neuronal differentiation was induced by means of a medium that contained basic fibroblast growth factor. After another 5 days, cultures were processed for immunocytochemical analysis. Results: The probability of finding olfactory epithelium in a biopsy specimen ranged from 30% to 76%, depending on its location. The dorsoposterior regions of the nasal septum and the superior turbinate provided the highest probability, but, surprisingly, olfactory epithelium was also found anteriorly and ventrally on both septum and turbinates. A new method of culturing the olfactory epithelium was devised. This slice culture technique improved the success rate for generating olfactory neurons from 10% to 90%. Conclusions: This study explains and overcomes most of the variability in the success in observing neurogenesis in cultures of adult human olfactory epithelium. The techniques presented here make the human olfactory epithelium a useful model for clinical research into certain olfactory dysfunctions and a model for the causes of neurodevelopmental and neurodegenerative diseases.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

1 Voltage-operated calcium channel (VOCC) antagonists are effective antihypertensive and antianginal agents but they also depress myocardial contractility. 2 We compared four L-type calcium channel antagonists, felodipine, nifedipine, amlodipine and verapamil and a relatively T-type selective calcium channel antagonist, mibefradil, on human and rat isolated tissue assays to determine their functional vascular to cardiac tissue selectivity (V/C) ratio. 3 The V/C ratio was calculated as the ratio of the IC50 value of the antagonist that reduced (by 50%) submaximally contracted (K+ 62 mM) human small arteries from the aortic vasa vasorum (vascular, V) mounted in a myograph and the IC50 value of the antagonist that reduced (-)-isoprenaline (6 nM) submaximally stimulated human right atrial trabeculae muscle (cardiac, C) mounted in organ chambers. 4 The average pIC(50) Values (-log IC50 M) for the human vascular preparations were felodipine 8.30, nifedipine 7.78, amlodipine 6.64, verapamil 6.26 and mibefradil 6.22. The average pIC(50) values for the cardiac muscle were felodipine 7.21, nifedipine 6.95, verapamil 6.91, amlodipine 5.94, and mibefradil 4.61. 5 The V/C ratio calculated as antilog [pIC(50)V-pIC(50)C] is thus mibefradil 41, felodipine 12, nifedipine 7, amlodipine 5 and verapamil 0.2. 6 In rat small mesenteric arteries the pIC(50) values for the five drugs were similar to the values for human vasa vasorum arteries contracted by K+ 62 mM. However for methoxamine (10 mu M) contraction in the rat arteries the pIC(50) values were lower for felodipine 7.24 and nifedipine 6.23, but similar for verapamil 6.13, amlodipine 6.28 and mibefradil 5.91. 7 In conclusion in the human tissue assays, the putative T-channel antagonist mibefradil shows the highest vascular to cardiac selectivity ratio; some 3 fold higher than the dihydropyridine, felodipine, and some 200 fold more vascular selective than the phenylalkylamine, verapamil. This favourable vascular to cardiac selectivity for mibefradil, from a new chemical class of VOCC antagonist, may be explained by its putative T-channel selectivity.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

1. Classical L-type voltage-operated calcium channel (VOCC) antagonists dilate blood vessels, depress myocardial contractility and slow cardiac conduction. 2. We compared four L-type VOCC antagonists and a novel tetralol derivative, mibefradil, reportedly 10-fold more selective for T- (transient) over L-type VOCC in two in vitro assays of human tissue, namely isolated small arteries from the aortic vasa vasorum in a myograph and right atrial trabeculae muscle under isometric force conditions. 3. In arteries contracted with K+ (62 mmol/L), the relaxation pIC(50) values for the VOCC antagonists felodipine, nifedipine, amlodipine, verapamil and mibefradil were 8.30, 7.78, 6.64, 6.26 and 6.22, respectively. In atrial trabeculae, the pIC(50) values to inhibit the inotropic response to a submaximal concentration of isoprenaline (6 nmol/L) for felodipine, nifedipine, verapamil, amlodipine and mibefradil were 7.21, 6.95, 6.91, 5.94 and 4.61, respectively. 4. Taking the anti-log (pIC(50) vessel - pIC(50) atrium) the vascular relaxation to cardiac depression potency ratios for mibefradil, felodipine, nifedipine, amlodipine and verapamil were 41, 12, 7, 5 and 0.22, respectively. 5. We conclude that, in human tissue assays, perhaps T- over L-type VOCC selectivity confers the most favourable vascular selectivity on mibefradil. Alternatively, splice variants of L-type VOCC in the vasculature (CaV1.2b) may be more sensitive to mibefradil than the splice variants in the heart (CaV1.2a).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

It is now well recognized that cervical cancer is caused by infection with certain human papillomavirus (HPV) subtypes and while interferon-alpha (IFN-alpha) is used to treat HPV-infected lesions, HPV appears to have developed a means to avoid the effects of IFN-alpha. Clinically, resistance appears to be associated with the expression of the E7 oncoprotein. Here we investigated the effects of expression in cells of the E7 protein from high- and low-risk papillomavirus subtypes on a range of responses to IFN-alpha. 2fTGH, a cell line dependent on IFN-alpha for growth in selection medium, grew significantly less well in the presence of E7, and the antiproliferative effects of IFN-alpha upon epithelial cells was lost upon E7 expression. The antiviral effects of IFN-alpha were abrogated in E7-expressing cells. Loss of response to IFN-alpha was found to occur in both high- and low-risk papillomaviruses. Finally, deletion of amino acids 21-24 of HPV type 16 E7 protein partially reversed repression. We conclude that E7 inhibits the functional effects of IFN-alpha and that this property is shared by all HPV subtypes tested. (C) 2000 Academic Press.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We investigated the recruitment behaviour of low threshold motor units in flexor digitorum superficialis by altering two biomechanical constraints: the load against which the muscle worked and the initial muscle length. The load was increased using isotonic (low load), loaded dynamic (intermediate load) and isometric (high load) contractions in two studies. The initial muscle position reflected resting muscle length in series A, and a longer length with digit III fully extended in series B. Intramuscular EMG was recorded from 48 single motor units in 10 experiments on five healthy subjects, 21 units in series A and,27 in series B, while subjects performed ramp up, hold and ramp down contractions. Increasing the load on the muscle decreased the force, displacement and firing rate of single motor units at recruitment at shorter muscle lengths (P < 0.001, dependent t-test). At longer muscle lengths this recruitment pattern was observed between loaded dynamic and isotonic contractions, but not between isometric and loaded dynamic contractions. Thus, the recruitment properties of single motor units in human flexor digitorum superficialis are sensitive to changes in both imposed external loads and the initial length of the muscle. (C) 2003 Elsevier Ltd. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Human sulfotransferase SULT1A1 is an important phase II xenobiotic metabolizing enzyme that is highly expressed in the liver and mediates the sulfonation of drugs, carcinogens, and steroids. Until this study, the transcriptional regulation of the SULT1A subfamily had been largely unexplored. Preliminary experiments in primary human hepatocytes showed that SULT1A mRNA levels were not changed in response to nuclear receptor activators, such as dexamethasone and 3-methylcolanthrene, unlike other metabolizing enzymes. Using HepG2 cells, the high activity of the TATA-less SULT1A1 promoter was shown to be dependent on the presence of Sp1 and Ets transcription factor binding sites (EBS), located within - 112 nucleotides from the transcriptional start site. The homologous promoter of the closely related SULT1A3 catecholamine sulfotransferase, which is expressed at negligible levels in the adult liver, displayed 70% less activity than SULT1A1. This was shown to be caused by a two-base pair difference in the EBS. The Ets transcription factor GA binding protein (GABP) was shown to bind the SULT1A1 EBS and could transactivate the SULT1A1 promoter in Drosophila melanogaster S2 cells. Cotransfection of Sp1 could synergistically enhance GABP-mediated activation by 10-fold. Although Sp1 and GABP alone could induce SULT1A3 promoter activity, the lack of the EBS on this promoter prevented a synergistic interaction between the two factors. This study reports the first insight into the transcriptional regulation of the SULT1A1 gene and identifies a crucial difference in regulation of the closely related SULT1A3 gene, which accounts for the two enzymes' differential expression patterns observed in the adult liver.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Relevância:

30.00% 30.00%

Publicador:

Resumo:

An immunoperoxidase technique was used to examine IP-10 (interferon-gamma inducible protein 10), RANTES (regulated on activation normal T cell expressed and secreted), MCP-1 (monocyte chemoattractant protein-1), and MIP-1alpha (macrophage inflammatory protein-1alpha) in gingival biopsies from 21 healthy/gingivitis and 26 periodontitis subjects. The samples were placed into 3 groups according to the size of infiltrate. MIP-1alpha+ cells were more abundant than the other chemokines with few MCP-1+ cells. The mean percent MIP-1alpha+ cells was higher than the percent MCP-1+ cells (P = 0.02) in group 2 (intermediate size infiltrates) lesions from periodontitis subjects, other differences not being significant due to the large variations between tissue samples. Analysis of positive cells in relation to CD4/CD8 ratios showed that with an increased proportion of CD8+ cells, the mean percent MIP-1alpha+ cells was significantly higher in comparison with the mean percent RANTES+ and MCP-1+ cells (P < 0.015). Endothelial cells were MCP-1+ although positive capillaries were found on the periphery of infiltrates only. Keratinocyte expression of chemokines was weak and while the numbers of healthy/gingivitis and periodontitis tissue sections positive for IP-10, RANTES and MCP-1 reduced with increasing inflammation, those positive for MIP-1alpha remained constant for all groups. In conclusion, fewer leucocytes expressed MCP-1 in gingival tissue sections, however, the percent MIP-1alpha+ cells was increased particularly in tissues with increased proportions of CD8 cells and B cells with increasing inflammation and also in tissues with higher numbers of macrophages with little inflammation. Further studies are required to determine the significance of MIP-1alpha in periodontal disease.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

An immunoperoxidase technique was used to examine CD28, CD152, CD80 and CD86 positive cells in gingival biopsies from 21 healthy/gingivitis and 26 periodontitis subjects. The samples were placed into 3 groups (small, intermediate, large) according to the size of the infiltrate. The percent CD28+ T cells in the connective tissue infiltrates was highly variable with no differences between the healthy/gingivitis and periodontitis groups. While there was an increase in positive cells in intermediate infiltrates from both healthy/gingivitis (28.5%) and periodontitis (21.4%) patients compared with small infiltrates (8.6% and 11.8%, respectively), this was not significant, although the percent CD28+ T cells did increase significantly in tissues with increased proportions of B cells relative to T cells (p=0.047). A mean of less than 5% infiltrating T cells were CD152+ which was significantly lower than the mean percent CD28+ T cells in intermediate healthy/gingivitis lesions (p=0.021). The mean percent CD80+ and CD86+ B cells and macrophages was 1–7% and 8–16%, respectively, the difference being significant in intermediate healthy/gingivitis tissues (p=0.012). Analysis of these cells in relation to increasing numbers of B cells in proportion to T cells and also to macrophages, suggested that CD80 was expressed predominantly by macrophages while CD86 was expressed by both macrophages and B cells. Few endothelial cells expressed CD80 or CD86. Keratinocytes displayed cytoplasmic staining of CD80 rather than CD86 although the numbers of positive specimens in the healthy/gingivitis and periodontitis groups reduced with increasing inflammation. In conclusion, percentages of CD28, CD152, CD80 and CD86 did not reflect differences in clinical status. However, the percent CD28+ T cells increased with increasing size of infiltrate and with increasing proportions of B cells suggesting increased T/B cell interactions with increasing inflammation. The percent CD152+ cells remained low indicating that CD152 may not be involved in negative regulation of T cells in periodontal disease. CD80 and CD86 have been reported to promote Th1 and Th2 responses, respectively, and the higher percent CD86+ cells suggests a predominance of Th2 responses in both healthy/gingivitis and periodontitis tissues. Nevertheless, other factors including cytokines themselves and chemokines which modulate T cell cytokine profiles must be monitored to determine the nature of Th1/Th2 responses in periodontal disease.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The tendency to dizygotic (DZ) twinning is inherited in both humans and sheep, and a fecundity gene in sheep (FecB) maps to sheep chromosome 6, syntenic with human 4q21-25. Our aim was to see whether a gene predisposing to human DZ twinning mapped to this region. DNA was collected from 169 pairs and 17 sets of 3 sisters (trios) from Australia and New Zealand who had each had spontaneous DZ twins, mostly before the age of 35, and from a replication sample of 111 families (92 affected sister pairs) from The Netherlands. Exclusion mapping was carried out after typing 26 markers on chromosome 4, of which 8 spanned the region Likely to contain the human homologue of the sheep FecB gene. We used nonparametric affected sib pair methods for linkage analysis [ASPEX 2.2, Hinds and Risch, 1999]. Complete exclusion of linkage (lod < -2) of a gene conferring a relative risk for sibs as low as 1.5 ((s) > 1.5) was obtained for all but the p terminus region on chromosome 4. Exclusion in the syntenic region was stronger, down to lambda (s) = 1.3. We concluded that if there is a gene influencing DZ twinning on chromosome 4, its effect must be minor. (C) 2001 Wiley-Liss, Inc.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Immunocytochemical techniques were used to examine the distribution of neurons immunoreactive (-ir) for nitric oxide synthase (nNOS), somatostatin (SOM), neuropeptide Y (NPY), parvalbumin (PV), calbindin (CB) and calretinin (CH), in the inferotemporal gyros (Brodmann's area 21) of the human neocortex. Neurons that colocalized either nNOS or SOM with PV, CB or CR were also identified by double-labeling techniques. Furthermore, glutamate receptor subunit profiles (GluR1, GluR2/3, GluR2/4, GluR5/6/7 and NMDAR1) were also determined for these cells. The number and distribution of cells containing nNOS, SOM, NPY, PV, CB or CR differed for each antigen. In addition, distinct subpopulations of neurons displayed different degrees of colocalization of these antigens depending on which antigens were compared. Moreover, cells that contained nNOS, SOM, NPY, PV, GB or CR expressed different receptor subunit profiles. These results show that specific subpopulations of neurochemically identified nonpyramidal cells may be activated via different receptor subtypes. As these different subpopulations of cells project to specific regions of pyramidal calls, facilitation of subsets of these cells via different receptor subunits may activate different inhibitory circuits. Thus, various distinct, but overlapping, inhibitory circuits may act in concert in the modulation of normal cortical function, plasticity and disease.