Differences In Metabolic Profile In the Testes of Streptozotocin Induced Diabetes Mellitus Mice As Detected By 1H NMR

Contrary to the traditional view, recent studies suggest that diabetes mellitus has an adverse influence on male reproductive function. Our aim was to determine the affect of diabetes on the testicular environment by identifying and then assessing perturbations in small molecule metabolites. Testes were obtained from control and streptozotocin induced diabetic C57BL/6 mice, two, four and eight weeks post treatment. Diabetic status was confirmed by HbA1c, non fasting blood glucose, physiological condition and body weight. Protein free, low molecular weight, water soluble extracts were assessed using 1H NMR spectroscopy. Principal Component Analysis of the derived profiles was used to classify any variations and specific metabolites were identified based on their spectral pattern. Characteristic metabolite profiles were identified for control and diabetic animals with the most distinctive being from mice with the greatest physical deterioration and loss of bodyweight. Eight streptozotocin treated animals did not develop diabetes and displayed profiles similar to controls. Diabetic mice had decreases in creatine, choline and carnitine and increases in lactate, alanine and myo-inositol. Betaine levels were found to be increased in the majority of diabetic mice but decreased in two animals with severe loss of body weight and physical condition. The association between perturbations in a number of small molecule metabolites known to be influential in sperm function, with diabetic status and physiological condition, adds further impetus to the proposal that diabetes influences important spermatogenic pathways and mechanisms in a subtle and previously unrecognised manner.

Metabolic signatures of Huntington's disease (HD): 1H NMR analysis of the polar metabolome in post mortem human brain

Huntington’s disease (HD) is an autosomal neurodegenerative disorder affecting approximately 5-10 persons per 100,000 worldwide. The pathophysiology of HD is not fully understood but the age of onset is known to be highly dependent on the number of CAG triplet repeats in the huntingtin gene. Using 1H NMR spectroscopy this study biochemically profiled 39 brain metabolites in post-mortem striatum (n=14) and frontal lobe (n=14) from HD sufferers and controls (n=28). Striatum metabolites were more perturbed with 15 significantly affected in HD cases, compared with only 4 in frontal lobe (P<0.05; q<0.3). The metabolite which changed most overall was urea which decreased 3.25-fold in striatum (P<0.01). Four metabolites were consistently affected in both brain regions. These included the neurotransmitter precursors tyrosine and L-phenylalanine which were significantly depleted by 1.55-1.58-fold and 1.48-1.54-fold in striatum and frontal lobe, respectively (P=0.02-0.03). They also included L-leucine which was reduced 1.54-1.69-fold (P=0.04-0.09) and myo-inositol which was increased 1.26-1.37-fold (P<0.01). Logistic regression analyses performed with MetaboAnalyst demonstrated that data obtained from striatum produced models which were profoundly more sensitive and specific than those produced from frontal lobe. The brain metabolite changes uncovered in this first 1H NMR investigation of human HD offer new insights into the disease pathophysiology. Further investigations of striatal metabolite disturbances are clearly warranted.

Use of NMR metabolomic plasma profiling methodologies to identify illicit growth-promoting administrations

Detection of growth-promoter use in animal production systems still proves to be an analytical challenge despite years of activity in the field. This study reports on the capability of NMR metabolomic profiling techniques to discriminate between plasma samples obtained from cattle treated with different groups of growth-promoting hormones (dexamethasone, prednisolone, oestradiol) based on recorded metabolite profiles. Two methods of NMR analysis were investigated—a Carr–Purcell–Meiboom–Gill (CPMG)-pulse sequence technique and a conventional 1H NMR method using pre-extracted plasma. Using the CPMG method, 17 distinct metabolites could be identified from the spectra. 1H NMR analysis of extracted plasma facilitated identification of 23 metabolites—six more than the alternative method and all within the aromatic region. Multivariate statistical analysis of acquired data from both forms of NMR analysis separated the plasma metabolite profiles into distinct sample cluster sets representative of the different animal study groups. Samples from both sets of corticosteroid-treated animals—dexamethasone and prednisolone—were found to be clustered relatively closely and had similar alterations to identified metabolite panels. Distinctive metabolite profiles, different from those observed within plasma from corticosteroid-treated animal plasma, were observed in oestradiol-treated animals and samples from these animals formed a cluster spatially isolated from control animal plasma samples. These findings suggest the potential use of NMR methodologies of plasma metabolite analysis as a high-throughput screening technique to aid detection of growth promoter use.

The Unexpected Preference for the fac-Isomer with the Tris(5-ester-substituted-2,2′-bipyridine) Complexes of Ruthenium(II)

The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.

Self-assembled triple helicates with preferential helicity

The enantiomerically pure ligands LRR and LSS (N,N'-bis(-2,2'-bipyridyl-5-yl)carbonyl-(1S/R,2S/R)-(+/-)-1,2-diaminocyclohexane) have been synthesised by linking two 2,2'-bipyridine units by (R,R)- and (S,S)-1,2-diaminocyclohexane respectively. The crystal structure confirmed that the ligand had a twisted orientation between the two chelating units. The reaction of LRR and LSS with Fe(II), Co(III), Cd(II) and Zn(II) afforded dinuclear complexes confirmed by ES mass spectroscopy. CD spectroscopy indicated that the chiral diaminocyclohexane conferred helicity to the metal centre giving a dominant triple helicate diastereoisomer, with the LRR ligand giving a delta-configuration of each metal centre (P helicate) and the LSS ligand a lambda configuration (M helicate). 1H NMR spectroscopy confirmed a dominant major diastereoisomer with cadmium. The Zn(II) and Cd(II) complexes however were observed to undergo rapid ligand dissociation in solution.

The isolation and purification of tris-2,2'-bipyridine complexes of ruthenium(II) containing unsymmetrical ligands

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

An introduction to biological nuclear magnetic resonance spectroscopy

ABSTRACT Nuclear magnetic resonance (NMR) spectroscopy is one of the most powerful analytical techniques available to biology. This review is an introduction to the potential of this method and is aimed at readers who have little or no experience in acquiring or analyzing NMR spectra. We focus on spectroscopic applications of the magnetic resonance effect, rather than imaging ones, and explain how various aspects of the NMR phenomenon make it a versatile tool with which to address a number of biological problems. Using detailed examples, we discuss the use of 1H NMR spectroscopy in mixture analysis and metabolomics, the use of 13C NMR spectroscopy in tracking isotopomers and determining the flux through metabolic pathways (‘fluxomics’) and the use of 31P NMR spectroscopy in monitoring ATP generation and intracellular pH homeotasis in vivo. Further examples demonstrate how NMR spectroscopy can be used to probe the physical environment of a cell by measuring diffusion and the tumbling rates of individual metabolites and how it can determine macromolecular structures by measuring the bonds and distances which separate individual atoms. We finish by outlining some of the key challenges which remain in NMR spectroscopy and we highlight how recent advances— such as increased magnet field strengths, cryogenic cooling, microprobes and hyperpolarisation—are opening new avenues for today’s biological NMR spectroscopists.

An Investigation into the Dissolution Properties of Celecoxib Melt Extrudates: Understanding the Role of Polymer Type and Concentration in Stabilizing Supersaturated Drug Concentrations

In this study, the dissolution properties of celecoxib (CX) solid dispersions manufactured from Eudragit 4155F and polyvinylpyrrolidone (PVP) were evaluated. Hot-melt extrusion (HME) technology was used to prepare amorphous solid dispersions of drug/polymer binary systems at different mass ratios. The drug concentrations achieved from the dissolution of PVP and Eudragit 4155F solid dispersions in phosphate buffer, pH 7.4 (PBS 7.4) were significantly greater than the equilibrium solubility of CX (1.58 µg/mL). The degree of supersaturation increased significantly as the polymer concentration within the solid dispersion increased. The maximum drug concentration achieved by PVP solid dispersions did not significantly exceed the apparent solubility of amorphous CX. The predominant mechanism for achieving supersaturated CX concentrations in PBS 7.4 was attributed to stabilization of amorphous CX during dissolution. Conversely, Eudragit 4155F solid dispersions showed significantly greater supersaturated drug solutions particularly at high polymer concentrations. For example, at a drug/polymer ratio of 1:9, a concentration of 100 µg/mL was achieved after 60 min that was stable (no evidence of drug recrystallization) for up to 72 h. This clearly identifies the potential of Eudragit 4155F to act as a solubilizing agent for CX. These findings were in good agreement with the results from solubility performed using PBS 7.4 in which Eudragit 4155F had been predissolved. In these tests, Eudragit 4155F significantly increased the equilibrium solubility of CX. Solution 1H NMR spectra were used to identify drug/polymer interactions. Deshielding of CX aromatic protons (H-1a and H-1b) containing the sulfonamide group occurred as a result of dissolution of Eudragit 4155F solid dispersions, whereas deshielding of H-1a protons and shielding of H-1b protons occurred as a result of the dissolution of PVP solid dispersions. In principle, it is reasonable to suggest that the different drug/polymer interactions observed give rise to the variation in dissolution observed for the two polymer/drug systems.