190 resultados para simple loop
Resumo:
Loop-mediated isothermal amplification (LAMP) is an innovative technique that allows the rapid detection of target nucleic acid sequences under isothermal conditions without the need for complex instrumentation. The development, optimization, and clinical validation of a LAMP assay targeting the ctrA gene for the rapid detection of capsular Neisseria meningitidis were described. Highly specific detection of capsular N. meningitidis type strains and clinical isolates was demonstrated, with no cross-reactivity with other Neisseria spp. or with a comprehensive panel of other common human pathogens. The lower limit of detection was 6 ctrA gene copies detectable in 48 min, with positive reactions readily identifiable visually via a simple color change. Higher copy numbers could be detected in as little as 16 min. When applied to a total of 394 clinical specimens, the LAMP assay in comparison to a conventional TaqMan® based real-time polymerase chain reaction system demonstrated a sensitivity of 100% and a specificity of 98.9% with a ? coefficient of 0.942. The LAMP method represents a rapid, sensitive, and highly specific technique for the detection of N. meningitidis and has the potential to be used as a point-of-care molecular test and in resource-poor settings.
Resumo:
Loop-mediated isothermal amplification (LAMP) is an innovative technique that allows the rapid detection of target nucleic acid sequences under isothermal conditions without the need for complex instrumentation. The development, optimization, and clinical validation of a LAMP assay targeting the ctrA gene for the rapid detection of capsular Neisseria meningitidis were described. Highly specific detection of capsular N. meningitidis type strains and clinical isolates was demonstrated, with no cross-reactivity with other Neisseria spp. or with a comprehensive panel of other common human pathogens. The lower limit of detection was 6 ctrA gene copies detectable in 48 min, with positive reactions readily identifiable visually via a simple color change. Higher copy numbers could be detected in as little as 16 min. When applied to a total of 394 clinical specimens, the LAMP assay in comparison to a conventional TaqMan® based real-time polymerase chain reaction system demonstrated a sensitivity of 100% and a specificity of 98.9% with a ? coefficient of 0.942. The LAMP method represents a rapid, sensitive, and highly specific technique for the detection of N. meningitidis and has the potential to be used as a point-of-care molecular test and in resource-poor settings.
Resumo:
This paper shows a simple, yet highly effective, tracking phase locked loop circuit which has applications for self steered antenna arrays. The tracking PLL has been demonstrated to accurately phase track signal levels as low as -120 dBm, making it suitable for applications such as SATCOM ground terminals. The implementation is simple requiring a low Q voltage controlled oscillator, a downconverting mixer and a PLL circuit.
Resumo:
This article describes an extremely simple wireless transceiver, comprising of only a low Q VCO and a phase locked loop IC. It is experimentally shown to, simultaneously, transmit an 8-dBm CW interrogation signal, while concurrently demodulating a phase modulated received signal with sensitivity levels of -120 dBm. This makes the performance similar to conventional transceivers, which require complex superheterodyne type architectures and also require a means to provide a high isolation separate the transmit/receive signals (such as a circulator).
Resumo:
Field-programmable gate arrays are ideal hosts to custom accelerators for signal, image, and data processing but de- mand manual register transfer level design if high performance and low cost are desired. High-level synthesis reduces this design burden but requires manual design of complex on-chip and off-chip memory architectures, a major limitation in applications such as video processing. This paper presents an approach to resolve this shortcoming. A constructive process is described that can derive such accelerators, including on- and off-chip memory storage from a C description such that a user-defined throughput constraint is met. By employing a novel statement-oriented approach, dataflow intermediate models are derived and used to support simple ap- proaches for on-/off-chip buffer partitioning, derivation of custom on-chip memory hierarchies and architecture transformation to ensure user-defined throughput constraints are met with minimum cost. When applied to accelerators for full search motion estima- tion, matrix multiplication, Sobel edge detection, and fast Fourier transform, it is shown how real-time performance up to an order of magnitude in advance of existing commercial HLS tools is enabled whilst including all requisite memory infrastructure. Further, op- timizations are presented that reduce the on-chip buffer capacity and physical resource cost by up to 96% and 75%, respectively, whilst maintaining real-time performance.
Resumo:
In this paper we advocate the Loop-of-stencil-reduce pattern as a way to simplify the parallel programming of heterogeneous platforms (multicore+GPUs). Loop-of-Stencil-reduce is general enough to subsume map, reduce, map-reduce, stencil, stencil-reduce, and, crucially, their usage in a loop. It transparently targets (by using OpenCL) combinations of CPU cores and GPUs, and it makes it possible to simplify the deployment of a single stencil computation kernel on different GPUs. The paper discusses the implementation of Loop-of-stencil-reduce within the FastFlow parallel framework, considering a simple iterative data-parallel application as running example (Game of Life) and a highly effective parallel filter for visual data restoration to assess performance. Thanks to the high-level design of the Loop-of-stencil-reduce, it was possible to run the filter seamlessly on a multicore machine, on multi-GPUs, and on both.
Resumo:
Natural landscape boundaries between vegetation communities are dynamically influenced by the selective grazing of herbivores. Here we show how this may be an emergent property of very simple animal decisions, without the need for any sophisticated choice rules etc., using a model based on biased diffusion. Animal grazing intensity is coupled with plant competition, resulting in reaction-diffusion dynamics, from which stable boundaries spontaneously emerge. In the model, animals affect their resources by both consumption and trampling. It is assumed that forage consists of two heterogeneously distributed competing resource species, one that is preferred (grass) over the other (heather) by the animals. The solutions to the resulting system of differential equations for three cases a) optimal foraging, b) random walk foraging and c) taxis-diffusion are presented. Optimal and random foraging gave unrealistic results, but taxis-diffusion accorded well with field observations. Persistent boundaries between patches of near-monoculture vegetation were predicted, with these boundaries drifting in response to overall grazing pressure (grass advancing with increased grazing and vice versa). The reaction-taxis-diffusion model provides the first mathematical explanation for such vegetation mosaic dynamics and the parameters of the model are open to experimental testing.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
A new quadrifilar antenna has been developed for generating circularly polarized backfire radiation. The antenna consists of two orthogonal rectangular conducting loops, each incorporating capacitive coupling and fed using either a single or two coaxial cables. Though the geometry is much simpler than a conventional quadrifilar helix antenna, the radiation pattern performance is very similar. Measured and simulated patterns are compared for two antennas with different feed arrangements. It is shown that the resonant structure can produce a cardioid pattern with a directivity of 4.5 dB (120 3-dB beamwidth) and a front-to-back ratio of more than 20 dB at the center operating frequency. A 10% impedance bandwidth (VSWR