Efficient heterogeneous asymmetric catalysis of the Mukaiyama aldol reaction by silica- and ionic liquid-supported Lewis acid copper(II) complexes of bis(oxazolines)

Lewis acid complexes based on copper(II) and an imidazolium-tagged bis(oxazoline) have been used to catalyse the asymmetric Mukaiyama aldol reaction between methyl pyruvate and 1-methoxy-1-tri-methylsilyloxypropene under homogeneous and heterogeneous conditions. Although the ees obtained in ionic liquid were similar to those found in dichloromethane, there was a significant rate enhancement in the ionic liquid with reactions typically reaching completion within 2 min compared with only 55% conversion after 60 min in dichloromethane. However, this rate enhancement was offset by lower chemoselectivity in ionic liquids due to the formation of 3-hydroxy-1,3-diphenylbutan-1-one as a by-product. Supporting the catalyst on silica or an imidazolium-modified silica using the ionic liquid or in an ionic liquid-diethyl ether system completely suppressed the formation of this by-product without reducing the enantioselectivity. Although the heterogeneous systems were characterised by a drop in catalytic activity the system could be recycled up to five times without any loss in conversion or ee.

Mandelohydroxamic acid as ligand for copper(II) 15-metallacrown-5 lanthanide(III) and copper(II) 15-metallacrown-5 uranyl complexes

The formation of pentanuclear copper(ii) complexes with the mandelohydroxamic ligand was studied in solution by electrospray ionization mass spectrometry (ESI-MS), absorption spectrophotometry, circular dichroism and H-1 NMR spectroscopy. The presence of lanthanide(iii) or uranyl ions is essential for the self-assembly of the 15-metallacrown-5 compounds. The negative mode ESI-MS spectra of solutions containing copper(II), mandelohydroxamic acid and lanthanide(iii) ions (Ln = La, Ce, Nd, Eu, Gd, Dy, Er, Tm, Lu, Y) or uranyl in the ratio 5:5:1 showed only the peaks that could be unambiguously assigned to the following intact molecular ions: {Ln(NO3)(2)[15-MCuIIN(MHA)-5](2-)}(-) and {Ln(NO3)[15-MCCuIIN(MHA)-5](3-)}(-), where MHA represents doubly deprotonated mandelohydroxamic acid. The NMR spectra of the pentanuclear species revealed only one set of peaks indicating a fivefold symmetry of the complex. The pentanuclear complexes synthesized with the enantiomerically pure R- or S-forms of mandelohydroxamic acid ligand, showed circular dichroism spectra which were mirror images of each other. The pentanuclear complex made from the racemic form of the ligand showed no signals in the CD spectrum. The UV/ Vis titration experiments revealed that the order in which the metal salts are added to the solution of the mandelohydroxamic acid ligand is crucial for the formation of metallacrown complexes. The addition of copper(ii) to the solutions containing mandelohydroxamic acid and neodymium(iii) in a 5:1 ratio lead to the formation of a pentanuclear complex in solution. In contrary, titration of lanthanide(iii) salt to the solution containing copper(ii) and mandelohydroxamic acid did not show any evidence for the formation of pentanuclear species. ((c) Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, Germany, 2006)

Coordination Properties of Ionic Liquid-Mediated Chromium(II) and Copper(II) Chlorides and Their Complexes with Glucose

The structural and coordination properties of complexes formed upon the interaction of copper(II) and chromium(II) chlorides with diallrylimidazolium chloride (RMlm(+)Cl(-)) ionic liquids and glucose are studied by a combination of density functional theory (DFT) calculations and X-ray absorption spectroscopy (XAS). In the absence of the carbohydrate substrate, isolated mononuclear four-coordinated MeCl42- species (Me = Cu, Cr) dominate in the ionic liquid solution. The organic part of the ionic liquid does not directly interact with the metal centers. The interactions between the RMlm(+) cations and the anionic metal chloride complexes are limited to hydrogen bonding with the basic Cl- ligands and the overall electrostatic stabilization of the anionic metal complexes. Exchange of Cl ligands by a hydroxyl group of glucose is only favorable for CrCl42-. For Cu2+ complexes, the formation of hydrogen bonded complexes between CuCl42- and glucose is preferred. No preference for the coordination of metal chloride species to specific hydroxyl group of the carbohydrate is found. The formation of binuclear metal chloride complexes is also considered. The reactivity and selectivity patterns of the Lewis acid catalyzed reactions of glucose are discussed in the framework of the obtained results.

Ionic Liquid Effect on the Reversal of Configuration for the Magnesium(II) and Copper(II) Bis(oxazoline)-Catalysed Enantioselective Diels-Alder Reaction

Ionic liquids have been used to support a range of magnesium-and copper-based bis(oxazoline) complexes for the enantioselective Diels-Alder reaction between N-acryloyloxazolidinone and cyclopentadiene. Compared with reaction performed in dichloromethane or diethyl ether, an enhancement in ee is observed with a large increase in reaction rate. In addition, for non-sterically hindered bis(oxazoline) ligands, that is, phenyl functionalised ligands, a reversal in configuration is found in the ionic liquid, 1-ethyl-3-methylimidazolium bis[(trifluoromethanesulfonyl)imide], compared with molecular solvents. Supported ionic liquid phase catalysts have also been developed using surface-modified silica which show good reactivity and enantioselectivity for the case of the magnesium-based bis(oxazoline) complexes. Poor ees and conversion were observed for the analogous copper-based systems. Some drop in ee was found on supporting the catalyst due a drop in the rate of reaction and, therefore, an increase in the contribution from the uncatalysed a chiral reaction.

Cobalt(II) Complexes of Nitrile-Functionalized Ionic Liquids

A series of nitrile-functionalized ionic liquids were found to exhibit temperature-dependent miscibility (thermomorphism) with the lower alcohols. Their coordinating abilities toward cobalt(II) ions were investigated through the dissolution process of cobalt(II) bis(trifluoromethylsulfonyl)imide and were found to depend on the donor abilities of the nitrile group. The crystal structures of the cobalt(II) solvates [Co(C1C1CNPyr)2(Tf2N)4] and [Co(C1C2CNPyr)6][Tf2N]8, which were isolated from ionic-liquid solutions, gave an insight into the coordination chemistry of functionalized ionic liquids. Smooth layers of cobalt metal could be obtained by electrodeposition of the cobalt-containing ionic liquids.

Kinetics and mechanism of a fast leuco-Methylene Blue oxidation by copper(II)-halide species in acidic aqueous media

The kinetics of a fast leuco-Methylene Blue (LMB) re-oxidation to Methylene Blue (MB) by copper(II)-halide (Cl-, Br-) complexes in acidic aqueous media has been studied spectrophotometrically using a stopped-flow technique. The reaction follows a simple first order rate expression under an excess of the copper(II) species (and H+(aq)), and the pseudo-first order rate constant (k'(obs)) is largely independent of the atmosphere used (air, oxygen, argon). The rate law, at constant Cl- (Br-) anion concentration, is given by the expression: (d[MB+])/dt = ((k(a)K[H+] + k(b))/(1 + K[H+])).[Cu-II][LMB] = k'(obs)[LMB], where K is the protonation constant, and k(a) and k(b) are the pseudo-second order rate constants for protonated and deprotonated forms of LMB, respectively The rate law was determined based on the observed k'(obs) vs. [Cu-II] and [H+] dependences. The rate dramatically increases with [Cl-] over the range: 0.1-1.5 M, reflecting the following reactivity order: Cu2+(aq)

A modular approach to luminescent dinuclear ruthenium(II) and rhenium(I) complexes

A series of dinuclear (bipyridine)tricarbonylrhenium(I) and tris(bipyridine)ruthenium(II) complexes have been isolated and characterised, bridged by a flexible diamido ethylene glycol chain. A new stepwise synthetic pathway has been investigated to heterometallic complexes, with the rhenium(I) complexes exhibiting an unusual configuration and inequivalence of the metal centres potentially arising from a surprising hydrogen-bonding interaction between an Re–CO group and an amide proton in low-polarity solvents. This interaction appears to be broken by competing hydrogen-bonding species such as dihydrogen phosphate. This effect was not observed in the corresponding ruthenium(II) complexes, which showed very little interaction with anions. The photophysical characterisation shows that the inclusion of two ester/amide groups to the rhenium centre effectively quenches the fluorescence at room temperature. The ruthenium(II) complexes have considerably stronger fluorescence than the rhenium species, and are less affected by theinclusion of ester and amide groups to the 2,2'-bipyridine chelating group.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Bis(trifluoromethyl)mercury(II) complexes with purine and 3,5-dimethyl-4 '-amino-triazole as ligands, [Hg(CF3)(2)(Pur)](4) and [Hg(CF3)(2)(Dat)](2)

Colourless single crystals of [Hg(CF3)(2)(Pur)](4) and [Hg(CF3)(2)(Dat)](2) were obtained from aqueous and etheric solutions of the respective components Purine, (imidazo[4,5-d]pyrimidine, Pur), 3,5-dimethyl-4 '-amino-triazole (Dat) and bis(trifluoromethyl)mercury(II), Hg(CF3)(2). [Hg(CF3)(2)(Pur)](4) crystallizes with the tetragonal system (P-4, Z = 8, a = 1486.8(2), c = 1026.2(l) pm, R-all = 0.0657) with tetrameric molecules consisting of four purine molecules bridged by slightly bent Hg(CF3)2 molecules forming a cage with the CF3 ligands surrounding this cage. The two modifications of [Hg(Dat)(CF3)2]2 (1: 170 K, triclinic, P-1, Z = 2, a 814.9(2), b = 845.4(2), c = 968.4(3) pm, alpha = 106.55(2)degrees, beta= 103.41(2)degrees, gamma = 110.79(2)degrees, R-all = 0.1189; II: monoclinic, P2(1)/c, Z = 8, a = 879.8(2), b = 1731.0(3), c = 1593.9(3) pm, beta = 106.89(2)degrees, R-all = 0.1199) both contain dimeric molecules that are stacked parallel to one crystal axis to strands which are arranged in a parallel fashion in I and rotated against each other in 11 by 110 degrees. In both, the tetrameric [Hg(CF3)(2)(Pur)](4) and the dimeric [Hg(CF3)(2)(Dat)](2) the Hg(CF3)(2) molecules are slightly bent (around 167 and 170 degrees) and rather weakly attached to the N-donor ligands Pur and Dat with Hg-N distances around 272 pm, although in both cases the Hg atoms bridge between two ligand molecules.

Sequential C-H and C-Ru bond formation and cleavage during the thermally induced rearrangement of aryl ruthenium(II) complexes with [C6H3(CH2NMe2)(2)-2,6](-) as a bidentate eta(2)-C,N coordinated ligand. The crystal structures of the isomeric pairs [RuCl{eta(6)-C10H14}{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,n}] (n = 4 or 6) and [Ru(eta(5)-C5H5){(eta(2)-C,N-C6H3(CH2NMe2)(2)-2,n} (PPH3)] (n = 4 or 6)

New air-stable ruthenium(II) complexes that contain the aryldiamine ligand [C6H3(CH2-NMe2)(2)-2,6](-) (NCN) are described. These complexes are [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(6)-C10H14)] (2; C10H14 = p-cymene = C6H4Me-Pr-i-4), [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(5)-C5H5)(PPh3)] (5), and their isomeric forms [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(6)-C10H14)] (3) and [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(5)-C5H5)(PPh3)] (6), respectively. Complex 2 has been prepared from the reaction of [Li(NCN)](2) with [RuCl2(eta(6)-C10H14)](2), whereas complex 5 has been prepared by the treatment of [RuCl{eta(3)-N,C,N-C6H3(CH2NMe2)(2)-2,6}(PPh3)] (4) with [Na(C5H5)](n). Both 2 and 5 are formally 18-electron ruthenium(II) complexes in which the monoanionic potentially tridentate coordinating ligand NCN is eta(2)-C,N-bonded, In solution (halocarbon solvent at room temperature or in aromatic solvents at elevated temperature), the intramolecular rearrangements of 2 and 5 afford complexes 3 and 6, respectively. This is a result of a shift of the metal-C-aryl bond from position-1 to position-3 on the aromatic ring of the NCN ligand. The mechanism of the isomerization is proposed to involve a sequence of intramolecular oxidative addition and reductive elimination reactions of both aromatic and aliphatic C-H bonds. This is based on results from deuterium labeling, spectroscopic studies, and some kinetic experiments. The mechanism is proposed to contain fully reversible steps in the case of 5, but a nonreversible step involving oxidative addition of a methyl NCH2-H bond in the case of 2. The solid-state structures of complexes 2, 3, 5, and 6 have been determined by single-crystal X-ray diffraction. A new dinuclear 1,4-phenylene-bridged bisruthenium(II) complex, [1,4-{RuCl(eta(6)-C10H14)}(2){C-6(CH2NMe2)(4)-2,3,5,6-C,N,C',N'}] (9) has also been prepared from the dianionic ligand [C-6(CH2NMe2)(4)-2,3,5,6](2-) (C2N4). The C2N4 ligand is in an eta(2)-C,N-eta(2)-C',N'-bis(bidentate) bonding mode. Compound 9 does not isomerize in solution (halocarbon solvent), presumably because of the absence of an accessible C-aryl-H bond. Complex 9 could not be isolated in an analytically pure form, probably because of its high sensitivity to air and very low solubility, which precludes recrystallization.

Double cyclometalation via carbon-silicon bond cleavage by palladium(II) acetate. X-ray structure of a cationic 1,4-dipalladated benzene ring and selective synthesis of heterobimetallic 1,4-phenylene-bridged platinum(II)-palladium(II) complexes

The disilylated compound 1,4-bis(trimethylsilyl)-2,3,5,6-tetrakis((dimethylamino)methyl)benzene, (Me(3)Si)(2)C2N4, 4, can be electrophilically palladated selectively at the C-Si bonds to afford the neutral 1,4-bis(palladium) complex [(AcOPd)(2)(C2N4)], from which the dicationic [(LPd)(2)(C2N4)](2+) (L = MeCN) organometallic species are accessible. The monosilylated species (Me(3)Si)(H)C2N4, 5, can be used for the preparation of the dicationic heterodinuclear platinum(II)-palladium(II) species [(LPd)(LPt)(C2N4)](2+) (L = MeCN) via a sequence of transmetalation of the organolithium derivative of 5 with [PtCl2(SEt(2))(2)], followed by a C-Si bond palladation reaction.

Versatile N,C,N coordination behavior of a monoanionic aryldiamine ligand in ruthenium(II) complexes: Syntheses and crystal structures of [Ru-II(C6H3(CH(2)NMe(2))(2)-2,6)X(L)] (L equals norbornadiene, X=Cl, SO3CF3; L=PPh(3), X=I) and [Ru-II{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6:2''-terpyridine)]Cl

The monoanionic ligand [C6H3(CH(2)NMe(2))(2)-2,6](-), a potentially terdentate N,C,N bonding system, has been employed to synthesize a series of new ruthenium(II) complexes [Ru{C6H3(CH(2)NMe(2))(2)-2,6}X(L)] (L = PPh(3) X = Cl (2a), I (2b); L = norbornadiene (nbd), X = Cl (4), eta(1)-OSO2CF3 (5)) and [Ru{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6',2 ''-terpyridine)]Cl (3). X-ray crystal structures of 2b and 3-5 have been determined, in which the N,C,N coordination geometry with respect to the metal center is found to differ considerably. In each complex the aryldiamine ligand is terdentate, eta(3)-N,C,N-bonded as a six electron donor system. However, depending on the other ligands in the Ru(II) coordination sphere, this ligand demonstrates considerable flexibility in adopting coordination geometries which range from meridional in 3 through pseudomeridional in 2b to pseudofacial in 4 and 5. In the structures of 4 and 5 significant distortions of the aryl ring, involving bending of the six-membered ring into a boatlike conformation, are found. The different combinations of the N,C,N ligand with sets of other ligands lead to a range of metal geometries, i.e. square pyramidal in 2b, octahedral in 3, and bicapped tetrahedral in 4 and 5.

Transformation of vaterite into calcite in the absence and the presence of copper(II) species. Thermal analysis, IR and EPR study

The transformation of vaterite into calcite may be performed by heating in the presence and the absence of oxygen. Vaterite remains thermally stable until a calcination temperature of 450°C. It transforms progressively to calcite up to 500°C giving two exothermic peaks: 1) at 481°C due to the transformation of vaterite surface which is in contact with a small amount of calcite phase already formed with the time on the solid surface from the humidity atmosphere; 2) at 491°C due to the transformation of pure vaterite bulk. The calcite phase remains stable until 700°C. Above this temperature the formation of CaO is observed.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.