22 resultados para Transactions et Instruments Financiers Dérivés Complexes
Resumo:
2-Phosphanylethylcyclopentadienyl lithium compounds, Li[C5R'(4)(CH2)(2)PR2] (R = Et, R' = H or Me, R = Ph, R' = Me), have been prepared from the reaction of spirohydrocarbons C5R'(4)(C2H4) with LiPR2. C5Et4HSiMe2CH2PMe2, was prepared from reaction of Li[C5Et4] with Me2SiCl2 followed by Me2PCH2Li. The lithium salts were reacted with [RhCl(CO)2]2,[IrCl(CO)3] or [Co-2(CO)(8)] to give [M(C5R'(4)(CH2) 2PR2)(CO)] (M = Rh, R = Et, R' = H or Me, R= Ph, R' = Me; M = Ir or Co, R = Et, R' = Me), which have been fully characterised, in many cases crystallographically as monomers with coordination of the phosphorus atom and the cyclopentadienyl ring. The values of nu(CO) for these complexes are usually lower than those for the analogous complexes without the bridge between the cyclopentadienyl ring and the phosphine, the exception being [Rh(Cp'(CH2)(2)PEt2)(CO)] (Cp' = C5Me4), the most electron rich of the complexes. [Rh(C5Et4SiMe2CH2PMe2)(CO)] may be a dimer. [Co-2(CO)(8)] reacts with C5H5(CH2)(2)PEt2 or C5Et4HSiMe2CH2PMe2 (L) to give binuclear complexes of the form [Co-2(CO)(6)L-2] with almost linear PCoCoP skeletons. [Rh(Cp'(CH2)(2)PEt2)(CO)] and [Rh(Cp'(CH2)(2)PPh2)(CO)] are active for methanol carbonylation at 150 degrees C and 27 bar CO, with the rate using [Rh(Cp'(CH2)(2)PPh2)(CO)] (0.81 mol dm(-3) h(-1)) being higher than that for [RhI2(CO)(2)](-) (0.64 mol dm(-3) h(-1)). The most electron rich complex, [Rh(Cp'(CH2)(2)PEt2)(CO)] (0.38 mol dm(-3) h(-1)) gave a comparable rate to [Cp*Rh(PEt3)(CO)] (0.30 mol dm(-3) h(-1)), which was unstable towards oxidation of the phosphine. [Rh(Cp'(CH2)(2)PEt2)I-2], which is inactive for methanol carbonylation, was isolated after the methanol carbonylation reaction using [Rh(Cp'(CH2)(2)PEt2)(CO)].
Resumo:
Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.
Resumo:
The effects of diphosphine flexibility and bite angle on the structures and luminescence properties of Au(I) complexes have been investigated. A range of diphosphines based on heteroaromatic backbones [bis(2-diphenylphosphino)phenylether (dpephos), 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (xantphos), and 4,6-bis(diphenylphosphino)dibenzofuran (dbfphos)] has been used to prepare mono- and digold derivatives. A clear relationship between the presence of aurophilic contacts and the emission properties of dinuclear complexes has been observed, with one of the complexes studied, [Au(2)Cl(2)(micro-xantphos)], exhibiting luminescence thermochromism.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
The synthesis of three new homoleptic trischelate ruthenium( II) complexes bearing new 2,2'-bipyridine ligands, 5,5'-dibenzylamido-2,2'-bipyridine (L1) and 5-benzylamido-2,2'- bipyridine (L2) has been achieved. In the case of [Ru(L2)(3)](2+), the mer and fac isomers have been separated. H-1 NMR spectroscopic anion binding studies indicate that the two C-3-symmetric pockets provided by [ Ru(L1)(3)](2+) is conducive to receive a range of anions, although this is not readily reflected in the photophysical behaviour. The fac-isomer of [Ru(L2)(3)](2+) does appear to have an enhancement in the binding interactions over the mer form with dihydrogenphosphate salts, although the difference is much less marked with the spherical chloride ions. From X-ray crystallographic evidence, the ability to hold water in the "anion" binding cleft can inhibit the strength of the interactions with anions, giving rise to the observed selectivity for directional oxoanions such as dihydrogen phosphate.
Resumo:
The purpose of this paper is to review recent developments in the design and fabrication of Frequency Selective Surfaces (FSS) which operate above 300 GHz. These structures act as free space electromagnetic filters and as such provide passive remote sensing instruments with multispectral capability by separating the scene radiation into separate frequency channels. Significant advances in computational electromagnetics, precision micromachining technology and metrology have been employed to create state of the art FSS which enable high sensitivity receivers to detect weak molecular emissions at THz wavelengths. This new class of quasi-optical filter exhibits an insertion loss
Resumo:
The new complexes [Pt(dppp)(py)(2)][OTf](2), 1, [Pt(dppp)(2-ap)(2)][OTf](2), 2, [(dppp)Pt(mu -OH){mu -NH(C5H3N)NH2}Pt(dppp)][OTf](2), 3 (py=pyridine, 2-ap=2-aminopyridine, NH(C5H3N)NH2=2,6-diaminopyridine anion, dppp = 1,3-bis(diphenylphosphino)propane, OTf=O3SCF3) have been prepared via reactions between [Pt(dppp)(OTf)(2)] and pyridine, 2-aminopyridine or 2,6-diaminopyridine (2,6-dap) respectively. The amines exhibit a range of co-ordination modes. Pyridine and 2-aminopyridine co-ordinate to platinum through endo-nitrogen atoms in complexes 1 and 2, the latter existing as a pair of rotomers due to the steric hindrance introduced by the 2-substituent. However, 2,6-diaminopyridine co-ordinates to platinum through the exo-nitrogen of one amino group, to give the unusual mu -amido complex 3. Reaction of the known orotate chelate complex [Pt(PEt3)(2)(N,O-HL)] [HL=orotate, the dianion of 2,6-dioxo-1,2,3,6-tetrahydropyrimidine-4-carboxylic acid (orotic acid)] with 2,6-dap gave [Pt(PEt3)(2)(2,6-dap)(N-HL)] 4, which contains an unconventional monodentate orotate ligand. In this co-ordination mode the orotate retains an ADA hydrogen bonding site and was found to co-crystallise with 2,6-dap via complementary ADA:DAD triple hydrogen bonds to give [Pt(PEt3)(2)(N-HL)(2,6-dap)].2,6-dap, 5. Complex 5 exhibits a helical chain structure of associated [1+1] adducts in the solid state.
Resumo:
A new class of platinum-bipyridyl compounds has been synthesized by the dehydrohalogenative reaction of [4,4'-bis(tert-butyl)-2,2'-bipyridyl]platinum dichloride [PtCl2((t)Bu(2)bipy)] 1 with terminal alkynes HC=CR, in the presence of copper(I) iodide and diisopropylamine. The products [Pt(C=CR)(2)((t)Bu(2)bipy)] (R=C6H4NO2-p 2, C6H5 3, C6H4CH3-p 4 or SiMe3 5), have been characterised by spectroscopic and analytical methods, and a single crystal molecular structure determination has been carried out on 4. Extended Huckel molecular orbital calculations have also been carried out, and the results are used to help rationalise the voltammetric, EPR and spectroelectrochemical properties of the new compounds. These show that compounds 3, 4 and 5 undergo a one-electron bipyridyl based redox process, but that 2 has an unresolved two-electron process located on the nitro groups.
Resumo:
The new complexes [NEt3H][M(HL)(cod)] (M = Rh 1 or Ir 2; H3L = 2,6-dioxo-1,2,3,6-tetrahydropyrimidine-4-carboxylic acid, erotic acid; cod = cycloocta-1,5-diene) have been prepared by the reaction between [M2Cl2(cod)(2)] and erotic acid in dichloromethane in the presence of Ag2O and NEt3. They crystallise as dichloromethane adducts 1 . CH2Cl2 and 2 . CH2Cl2 from dichloromethane-hexane solutions. These isomorphous structures contain doubly hydrogen-bonded dimers, with additional hydrogen bonding to NEt3H+ cations and bridging CH2Cl2 molecules to form tapes. The use of (NBu4OH)-O-n instead of NEt3 gave the related complex [NBu4n][Rh(HL)(cod)] 1' which has an innocent cation not capable of forming strong hydrogen bonds and in contrast to 1 exists as discrete doubly hydrogen-bonded dimers. Complex 1' cocrystallises with 2,6-diaminopyridine (dap) via complementary triple hydrogen bonds to give [NBu4n][Rh(HL)(cod)]. dap . CH2Cl2 3. Complex 3 exhibits an extended sheet structure of associated [2 + 2] units, with layers of NBu4n, cations separating the sheets. These structural data together with those reported previously for platinum orotate complexes suggest that the steric requirements of the other ligands co-ordinated to the metal are important in influencing their hydrogen-bonding abilities. The solvent of crystallisation, the hydrogen-bonding propensity of the coligand and the nature of the counter ion also determine the type of association in the solid state.