21 resultados para TERPYRIDYL COMPLEXES


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Symmetrical and unsymmetrical ligands containing terpyridyl coordinating units (N, N, N) or a cyclometalating equivalent (N, C, N), connected back-to-back either directly or via a p-terphenylene or 1,3-phenylene spacer, have been used to construct new diruthenium complexes. These compounds incorporate various terdentate chelates as capping ligands, to allow a double control of the electronic properties of each subcomplex and of the ensemble: via the terminal ligand or through the bridging fragment. Electronic coupling was studied from the intervalence transitions observed in several bimetallic ruthenium complexes of the bis-(cyclometalated) type differing by the substitution of a nitrogen atom by carbon in the terminal terpyridyl unit. The largest metal-metal interaction was found in complexes for which the terminal complexing unit is of the 1,3-di-2-pyridylbenzene type, i.e., with the carbon atom located on the metal-metal C-2 axis of the molecule. Investigations of the mechanism of interaction by extended Huckel calculations showed that the replacement of nitrogen by carbon raises the filled ligand levels, increasing the mixing with ligand orbitals and thus the metal-metal coupling. Finally, the intervalence transition was still observed for a bridging ligand containing three phenylene units as spacers, corresponding to a 24-Angstrom metal-metal distance.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The novel ligand 4'-diferrocenylallcyne-2,2':6',2 ''-terpyridine (7; Fc-C C-Fc-tpy; tpy = terpyridyl; Fc = ferrocenyl) and its Ru2+ complexes 8-10 have been synthesized and characterized by single-crystal X-ray diffraction, cyclic voltammetry, and UV-vis and luminescence spectroscopy. Electrochemical data and UV absorption and emission spectra indicate that the insertion of an ethynyl group causes delocalization of electrons in the extended pi* orbitals. Cyclic voltammetric measurements of 7 show two successive reversible one-electron-oxidation processes with half-wave potentials of 0.53 and 0.78 V. The small variations of the E-1/2 values for the Fe2+/Fe3+ redox couples after the coordination of the Ru2+ ion suggest a weak interaction between the Ru2+ and Fe2+ centers. After insertion of an ethynyl group, UV-vis absorption spectra show a red shift of the absorption peak of the (1)[(d(pi)(Fe))(6)]->(1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT of the Ru2+ complexes. The Ru2+ complex 8 exhibits the strongest luminescence intensity (lambda(em)(max) 712 nm, Phi(em) = 2.63 x 10(-4), tau = 323 ns) relative to analogous ferrocene-based terpyridine Ru(II) complexes in H2O/CH3CN (4/1 v/v) solution.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Two novel alkynyl-bridged symmetric bis-tridentate ligands 1,2-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]-ferrocenyl)ethyne (3a; tpy-Fc-C C-Fc-tpy; Fc = ferrocenyl; tpy = terpyridyl) and 1,4-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]ferrocenyl)-1,3-butadiyne (3b; tpy-Fc-C C-C C-Fc-tpy) and their Ru2+ complexes 6a and 6b have been synthesized and characterized by cyclic voltammetry, UV-vis and luminescence spectroscopy, and in the case of 3b by single-crystal X-ray diffraction. Cyclic voltammograms of both compounds, 3a and 3b, display two severely overlapping ferrocene-based oxidative peaks with only one reductive peak. The redox behavior of 6a and 6b is dominated by the Ru2+/Ru3+ redox couple (E-1/2 from 1.33 to 1.34 V), the Fe2+/Fe3+ redox couples (E-1/2 from 0.46 to 0.80 V), and the tpy/tpy(-)/tpy(2-)redox couples (E-1/2 from -1.19 to -1.48 V). The UV-vis spectra of 6a and 6b show absorption bands assigned to the (1)[(d(pi)(Fe))(6)] -> (1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT transition at similar to 555 nm. Complexes 6a and 6b are luminescent in H2O-CH3CN (4 : 1, v/v) solution at room temperature, and 6b exhibits the strongest luminescence intensity (lambda(em)(max): 710 nm, Phi(em): 2.28 x 10(-4), tau: 358 ns) relative to analogous ferrocene-based bis(terpyridine) Ru(II) complexes reported so far.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

High catalytic activity and selectivity has been demonstrated for the oxidation of both aliphatic and aromatic amines to nitriles under benign conditions with dioxygen or air using the Ru2Cl4(az-tpy)(2) complex. The conversion was found to be strongly influenced by the alkyl chain length of the reactant with shorter chain amines found to have lower conversions than those with longer chains. Importantly, by using the ruthenium terpyridine complex functionalized with azulenyl moiety at the 4 position of central pyridine core provided a much higher reactivity catalyst compared with a series of ruthenium terpyridine-based ligand complexes reported. Mechanistic studies using deuterated benzylamine demonstrated the importance of RuOH in this reaction.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Fac-ruthenium(II) tris-(5-carboxy-2,2'-bipyridine) has been synthesised as a single geometric isomer for the first time, and proves to be a good "building-block" to introduce new functionality with retention of the isomeric integrity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The effects of diphosphine flexibility and bite angle on the structures and luminescence properties of Au(I) complexes have been investigated. A range of diphosphines based on heteroaromatic backbones [bis(2-diphenylphosphino)phenylether (dpephos), 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (xantphos), and 4,6-bis(diphenylphosphino)dibenzofuran (dbfphos)] has been used to prepare mono- and digold derivatives. A clear relationship between the presence of aurophilic contacts and the emission properties of dinuclear complexes has been observed, with one of the complexes studied, [Au(2)Cl(2)(micro-xantphos)], exhibiting luminescence thermochromism.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The equilibrium structure of ErOn (nless than or equal to6) complexes in crystalline silicon has been investigated by density-functional computations. Two different geometries have been considered, corresponding to the substitutional and tetrahedral interstitial site for erbium. All atomic coordinates have been optimized by Car-Parrinello molecular dynamics. The resulting structures have low symmetry, with E-O distances of similar to2.35 Angstrom. The substitutional site is the most stable one for nless than or equal to2, while the tetrahedral interstitial is favored for n>2.