71 resultados para RUTHENIUM(II) COMPLEX


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Evolution can increase the complexity of matter by self-organization into helical architectures, the best example being the DNA double helix. One common aspect, apparently shared by most of these architectures, is the presence of covalent bonds within the helix backbone. Here, we report the unprecedented crystal structures of a metal complex that self-organizes into a continuous double helical structure, assembled by non-covalent building blocks. Built up solely by weak stacking interactions, this alternating tread stairs-like double helical assembly mimics the DNA double helix structure. Starting from a racemic mixture in aqueous solution, the ruthenium(II) polypyridyl complex forms two polymorphic structures of a left-handed double helical assembly of only the Λ-enantiomer. The stacking of the helices is different in both polymorphs: a crossed woodpile structure versus a parallel columnar stacking.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Tris-chelate 5-hydroxymethyl-2,2 '-bipyridine complexes of ruthenium (II) and the structurally related benzo- and naphthoesters have been isolated. The mer-isomer of the alcohol functionalised complex has been isolated by selective precipitation from methylene chloride and was subsequently functionalised to the benzoester with retention of the geometrical isomerism. The fac- and merisomeric forms of the ester complexes were separated using preparative plate silica chromatography and characterised by H-1 NMR spectroscopy. X-ray structural analysis of the fac-isomer of both the ester complexes confirmed the product assignment. The photophysical properties of the three isomers were investigated, indicating very similar absorption spectra to [Ru(biPY)(3)](2+). The emission wavelength was comparable in each case, with the aromatic ester complexes giving a much longer lifetime and higher quantum yields. (c) 2004 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

New air-stable ruthenium(II) complexes that contain the aryldiamine ligand [C6H3(CH2-NMe2)(2)-2,6](-) (NCN) are described. These complexes are [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(6)-C10H14)] (2; C10H14 = p-cymene = C6H4Me-Pr-i-4), [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(5)-C5H5)(PPh3)] (5), and their isomeric forms [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(6)-C10H14)] (3) and [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(5)-C5H5)(PPh3)] (6), respectively. Complex 2 has been prepared from the reaction of [Li(NCN)](2) with [RuCl2(eta(6)-C10H14)](2), whereas complex 5 has been prepared by the treatment of [RuCl{eta(3)-N,C,N-C6H3(CH2NMe2)(2)-2,6}(PPh3)] (4) with [Na(C5H5)](n). Both 2 and 5 are formally 18-electron ruthenium(II) complexes in which the monoanionic potentially tridentate coordinating ligand NCN is eta(2)-C,N-bonded, In solution (halocarbon solvent at room temperature or in aromatic solvents at elevated temperature), the intramolecular rearrangements of 2 and 5 afford complexes 3 and 6, respectively. This is a result of a shift of the metal-C-aryl bond from position-1 to position-3 on the aromatic ring of the NCN ligand. The mechanism of the isomerization is proposed to involve a sequence of intramolecular oxidative addition and reductive elimination reactions of both aromatic and aliphatic C-H bonds. This is based on results from deuterium labeling, spectroscopic studies, and some kinetic experiments. The mechanism is proposed to contain fully reversible steps in the case of 5, but a nonreversible step involving oxidative addition of a methyl NCH2-H bond in the case of 2. The solid-state structures of complexes 2, 3, 5, and 6 have been determined by single-crystal X-ray diffraction. A new dinuclear 1,4-phenylene-bridged bisruthenium(II) complex, [1,4-{RuCl(eta(6)-C10H14)}(2){C-6(CH2NMe2)(4)-2,3,5,6-C,N,C',N'}] (9) has also been prepared from the dianionic ligand [C-6(CH2NMe2)(4)-2,3,5,6](2-) (C2N4). The C2N4 ligand is in an eta(2)-C,N-eta(2)-C',N'-bis(bidentate) bonding mode. Compound 9 does not isomerize in solution (halocarbon solvent), presumably because of the absence of an accessible C-aryl-H bond. Complex 9 could not be isolated in an analytically pure form, probably because of its high sensitivity to air and very low solubility, which precludes recrystallization.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The monoanionic ligand [C6H3(CH(2)NMe(2))(2)-2,6](-), a potentially terdentate N,C,N bonding system, has been employed to synthesize a series of new ruthenium(II) complexes [Ru{C6H3(CH(2)NMe(2))(2)-2,6}X(L)] (L = PPh(3) X = Cl (2a), I (2b); L = norbornadiene (nbd), X = Cl (4), eta(1)-OSO2CF3 (5)) and [Ru{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6',2 ''-terpyridine)]Cl (3). X-ray crystal structures of 2b and 3-5 have been determined, in which the N,C,N coordination geometry with respect to the metal center is found to differ considerably. In each complex the aryldiamine ligand is terdentate, eta(3)-N,C,N-bonded as a six electron donor system. However, depending on the other ligands in the Ru(II) coordination sphere, this ligand demonstrates considerable flexibility in adopting coordination geometries which range from meridional in 3 through pseudomeridional in 2b to pseudofacial in 4 and 5. In the structures of 4 and 5 significant distortions of the aryl ring, involving bending of the six-membered ring into a boatlike conformation, are found. The different combinations of the N,C,N ligand with sets of other ligands lead to a range of metal geometries, i.e. square pyramidal in 2b, octahedral in 3, and bicapped tetrahedral in 4 and 5.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The novel ligand 4'-diferrocenylallcyne-2,2':6',2 ''-terpyridine (7; Fc-C C-Fc-tpy; tpy = terpyridyl; Fc = ferrocenyl) and its Ru2+ complexes 8-10 have been synthesized and characterized by single-crystal X-ray diffraction, cyclic voltammetry, and UV-vis and luminescence spectroscopy. Electrochemical data and UV absorption and emission spectra indicate that the insertion of an ethynyl group causes delocalization of electrons in the extended pi* orbitals. Cyclic voltammetric measurements of 7 show two successive reversible one-electron-oxidation processes with half-wave potentials of 0.53 and 0.78 V. The small variations of the E-1/2 values for the Fe2+/Fe3+ redox couples after the coordination of the Ru2+ ion suggest a weak interaction between the Ru2+ and Fe2+ centers. After insertion of an ethynyl group, UV-vis absorption spectra show a red shift of the absorption peak of the (1)[(d(pi)(Fe))(6)]->(1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT of the Ru2+ complexes. The Ru2+ complex 8 exhibits the strongest luminescence intensity (lambda(em)(max) 712 nm, Phi(em) = 2.63 x 10(-4), tau = 323 ns) relative to analogous ferrocene-based terpyridine Ru(II) complexes in H2O/CH3CN (4/1 v/v) solution.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fac-ruthenium(II) tris-(5-carboxy-2,2'-bipyridine) has been synthesised as a single geometric isomer for the first time, and proves to be a good "building-block" to introduce new functionality with retention of the isomeric integrity.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A series of dinuclear (bipyridine)tricarbonylrhenium(I) and tris(bipyridine)ruthenium(II) complexes have been isolated and characterised, bridged by a flexible diamido ethylene glycol chain. A new stepwise synthetic pathway has been investigated to heterometallic complexes, with the rhenium(I) complexes exhibiting an unusual configuration and inequivalence of the metal centres potentially arising from a surprising hydrogen-bonding interaction between an Re–CO group and an amide proton in low-polarity solvents. This interaction appears to be broken by competing hydrogen-bonding species such as dihydrogen phosphate. This effect was not observed in the corresponding ruthenium(II) complexes, which showed very little interaction with anions. The photophysical characterisation shows that the inclusion of two ester/amide groups to the rhenium centre effectively quenches the fluorescence at room temperature. The ruthenium(II) complexes have considerably stronger fluorescence than the rhenium species, and are less affected by theinclusion of ester and amide groups to the 2,2'-bipyridine chelating group.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The synthesis of three new homoleptic trischelate ruthenium( II) complexes bearing new 2,2'-bipyridine ligands, 5,5'-dibenzylamido-2,2'-bipyridine (L1) and 5-benzylamido-2,2'- bipyridine (L2) has been achieved. In the case of [Ru(L2)(3)](2+), the mer and fac isomers have been separated. H-1 NMR spectroscopic anion binding studies indicate that the two C-3-symmetric pockets provided by [ Ru(L1)(3)](2+) is conducive to receive a range of anions, although this is not readily reflected in the photophysical behaviour. The fac-isomer of [Ru(L2)(3)](2+) does appear to have an enhancement in the binding interactions over the mer form with dihydrogenphosphate salts, although the difference is much less marked with the spherical chloride ions. From X-ray crystallographic evidence, the ability to hold water in the "anion" binding cleft can inhibit the strength of the interactions with anions, giving rise to the observed selectivity for directional oxoanions such as dihydrogen phosphate.