BRCA1 and GADD45 mediated G2/M cell cycle arrest in response to antimicrotubule agents

BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.

BubR1 is required for the mitotic block induced by combretastatin-A4 and a novel cis-restricted ß-lactam analogue in human cancer cells

BubR1 is a well-defined guardian of the mitotic spindle, initiating mitotic arrest in response to the lack of tension and/or chromosome alignment across the mitotic plate. However, the role of BubR1 in combretastatin-induced cell death remains unknown. In this study, we describe the effects of combretastatin A-4 (CA-4) and a synthetic cis-restricted 3,4-diaryl-2-azetidinone (ß-lactam) analogue (CA-432) on the modulation and phosphorylation of BubR1 in human cervical cancer-derived cells. We demonstrate that CA-4 and CA-432 depolymerise the microtubular network of human cervical carcinoma-derived cells. Both compounds induced the disassembly of the microtubules and the loss of microtubule tension led to the early phosphorylation of BubR1 and the late cleavage of BubR1. The phosphorylation of BubR1 correlated with the onset of G2M cell cycle arrest whilst the cleavage of BubR1 coincided with apoptosis induced by the combretastatins. The combretastatin-induced apoptosis and the BubR1 cleavage were caspase-dependent. In vitro enzyme digests demonstrated that combretastatin-activated BubR1 is a substrate for caspase-3. Gene silencing of BubR1 with small interfering RNA severely compromised combretastatin-induced G2M cell cycle arrest with a corresponding increase in the formation of polyploid cells in both cervical and breast cancer-derived cells. In summary, BubR1 is required to maintain the G2M arrest and limit the formation of polyploid cells in response to continued combretastatin exposure. Moreover, substitution of the ethylene bridge with 3,4-diaryl-2-azetidinone did not alter the tubulin depolymerising properties or the subsequent mitotic spindle checkpoint response to CA-4 in human cancer cells.

Novel microtubule-targeting agents, pyrrolo-1,5-benzoxazepines, induce cell cycle arrest and apoptosis in prostate cancer cells

Advanced hormone-refractory prostate cancer is associated with poor prognosis and limited treatment options. Members of the pyrrolo-1,5-benzoxazepine (PBOX) family of compounds exhibit anti-cancer properties in cancer cell lines (including multi-drug resistant cells), ex vivo patient samples and in vivo mouse tumour models with minimal toxicity to normal cells. Recently, they have also been found to possess anti-angiogenic properties in vitro. However, both the apoptotic pathways and the overall extent of the apoptotic response induced by PBOX compounds tend to be cell-type specific. Since the effect of the PBOX compounds on prostate cancer has not yet been elucidated, the purpose of this study was to investigate if PBOX compounds induce anti-proliferative effects on hormone-refractory prostate cancer cells. We examined the effect of two representative PBOX compounds, PBOX-6 and PBOX-15, on the androgen-independent human prostate adenocarcinoma cell line, PC3. PBOX-6 and -15 displayed anti-proliferative effects on PC3 cells, mediated initially through a sustained G2/M arrest. G2/M arrest, illustrated as DNA tetraploidy, was accompanied by microtubule depolymerisation and phosphorylation of anti-apoptotic proteins Bcl-2 and Bcl-xL and the mitotic spindle checkpoint protein BubR1. Phosphorylation of BubR1 is indicative of an active mitotic checkpoint and results in maintenance of cell cycle arrest. G2/M arrest was followed by apoptosis illustrated by DNA hypoploidy and PARP cleavage and was accompanied by degradation of BubR1, Bcl-2 and Bcl-xL. Furthermore, sequential treatment with the CDK1-inhibitor, flavopiridol, synergistically enhanced PBOX-induced apoptosis. In summary, this in vitro study indicates that PBOX compounds may be useful alone or in combination with other agents in the treatment of hormone-refractory prostate cancer.

BubR1 is required for a sustained mitotic spindle checkpoint arrest in human cancer cells treated with tubulin-targeting pyrrolo-1,5-benzoxazepines

Intrinsic or acquired resistance to chemotherapy is a major clinical problem that has evoked the need to develop innovative approaches to predict and ultimately reverse drug resistance. A prolonged G(2)M arrest has been associated with apoptotic resistance to various microtubule-targeting agents (MTAs). In this study, we describe the functional significance of the mitotic spindle checkpoint proteins, BubR1 and Bub3, in maintaining a mitotic arrest after microtubule disruption by nocodazole and a novel series of MTAs, the pyrrolo-1,5-benzoxazepines (PBOXs), in human cancer cells. Cells expressing high levels of BubR1 and Bub3 (K562, MDA-MB-231, and HeLa) display a prolonged G(2)M arrest after exposure to MTAs. On the other hand, cells with low endogenous levels of mitotic spindle checkpoint proteins (SK-BR-3 and HL-60) transiently arrest in mitosis and undergo increased apoptosis. The phosphorylation of BubR1 correlated with PBOX-induced G(2)M arrest in four cell lines tested, indicating an active mitotic spindle checkpoint. Gene silencing of BubR1 by small interfering RNA interference reduced PBOX-induced G(2)M arrest without enhancing apoptotic efficacy. Further analysis demonstrated that PBOX-treated BubR1-depleted cells were both mononucleated and multinucleated with a polyploid DNA content, suggesting a requirement for BubR1 in cytokinesis. Taken together, these results suggest that BubR1 contributes to the mitotic checkpoint induced by the PBOXs.

Hepatocyte growth factor (HGF) protects c-met-expressing Burkitt''s lymphoma cell lines from apoptotic death induced by DNA damaging agents

The relative sensitivity of neoplastic cells to DNA damaging agents is a key factor in cancer therapy. In this paper, we show that pretreatment of Burkitt's lymphoma cell lines expressing the c-met protooncogene with hepatocyte growth factor (HGF) protects them from death induced by DNA damaging agents commonly used in tumour therapy. This protection was observed in assays based on morphological assessment of apoptotic cells and DNA fragmentation assays. The protection was dose- and time-dependent — maximal protection requiring pre-incubation with 100 ng/ml HGF for 48 h. Western blotting analysis and flow cytometric studies revealed that HGF inhibited doxorubicin- and etoposide-induced decreases in the levels of the anti-apoptotic proteins Bcl-XL, and to a lesser extent Bcl-2, without inducing changes in the pro-apoptotic Bax protein. Overall, these studies suggest that the accumulation of HGF within the microenvironment of neoplastic cells may contribute to the development of a chemoresistant phenotype.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.