Asymmetric Carbon-Carbon Bond Forming Reactions Catalysed by Metal(II) Bis(oxazoline) Complexes Immobilized using Supported Ionic Liquids

A series of bis(oxazoline) metal(II) complexes has been supported on silica and carbon supports by non-covalent immobilisation using an ionic liquid. The catalytic performance of these solids was compared for the enantioselective Diels-Alder reaction between N-acryloyloxazolidinone and cyclopentadiene and the Mukaiyama-aldol reaction between methyl pyruvate and 1-methoxy-1-trimethylsilyloxy-propene. In both reactions the enantioselectivity was strongly influenced by the choice of support displaying enantioselectivies (ee values) up to 40% higher than those conducted under homogeneous reaction conditions.

The nature of arsenic-phytochelatin complexes in Holcus lanatus and Pteris cretica

We have developed a method to extract and separate phytochelatins (PCs)-metal(loid) complexes using parallel metal(loid)-specific (inductively coupled plasma-mass spectrometry) and organic-specific (electrospray ionization-mass spectrometry) detection systems-and use it here to ascertain the nature of arsenic (As)-PC complexes in plant extracts. This study is the first unequivocal report, to our knowledge, of PC complex coordination chemistry in plant extracts for any metal or metalloid ion. The As-tolerant grass Holcus lanatus and the As hyperaccumulator Pteris cretica were used as model plants. In an in vitro experiment using a mixture of reduced glutathione (GS), PC(2), and PC(3), As preferred the formation of the arsenite [As((III))]-PC(3) complex over GS-As((III))-PC(2), As((III))-(GS)(3), As((III))-PC(2), or As((III))-(PC(2))(2) (GS: glutathione bound to arsenic via sulphur of cysteine). In H. lanatus, the As((III))-PC(3) complex was the dominant complex, although reduced glutathione, PC(2), and PC(3) were found in the extract. P. cretica only synthesizes PC(2) and forms dominantly the GS-As((III))-PC(2) complex. This is the first evidence, to our knowledge, for the existence of mixed glutathione-PC-metal(loid) complexes in plant tissues or in vitro. In both plant species, As is dominantly in non-bound inorganic forms, with 13% being present in PC complexes for H. lanatus and 1% in P. cretica.

Coordination Properties of Ionic Liquid-Mediated Chromium(II) and Copper(II) Chlorides and Their Complexes with Glucose

The structural and coordination properties of complexes formed upon the interaction of copper(II) and chromium(II) chlorides with diallrylimidazolium chloride (RMlm(+)Cl(-)) ionic liquids and glucose are studied by a combination of density functional theory (DFT) calculations and X-ray absorption spectroscopy (XAS). In the absence of the carbohydrate substrate, isolated mononuclear four-coordinated MeCl42- species (Me = Cu, Cr) dominate in the ionic liquid solution. The organic part of the ionic liquid does not directly interact with the metal centers. The interactions between the RMlm(+) cations and the anionic metal chloride complexes are limited to hydrogen bonding with the basic Cl- ligands and the overall electrostatic stabilization of the anionic metal complexes. Exchange of Cl ligands by a hydroxyl group of glucose is only favorable for CrCl42-. For Cu2+ complexes, the formation of hydrogen bonded complexes between CuCl42- and glucose is preferred. No preference for the coordination of metal chloride species to specific hydroxyl group of the carbohydrate is found. The formation of binuclear metal chloride complexes is also considered. The reactivity and selectivity patterns of the Lewis acid catalyzed reactions of glucose are discussed in the framework of the obtained results.

Polynuclear metal complexes obtained from the task-specific ionic liquid betainium bistriflimide

The task-specific ionic liquid betainium bis(trifluoromethylsulfonyl)imide, [Hbet][Tf2N], was used to dissolve metal oxides and hydroxides. The crystal structures of the resulting metal betaine bistriflimide complexes exhibit a rich structural variety. A trimeric structure was found for the cobalt(II) compound, [Co-3(bet)(8)(Hbet)(2)(H2O)(2)][Tf2N](9)[Hbet], a tetrameric structure for the manganese(II) and zinc(II) compound, [Mn-4(bet)(10)(H2O)(4)][Tf2N](8) and [Zn-4(bet)(10)(H2O)(2)][Tf2N](8), respectively, a pentameric structure for the nickel(II) compound, [Ni-5(bet)(12)(H2O)(6)][Tf2N](10), an oxo-hydroxo-cluster formation for the lead(II) compound, [(Pb4O)Pb(OH)(bet)(8)(Tf2N)3] [Tf2N](4)center dot MeOH, and a polymeric structure for the silver(I) compound, [Ag-2(bet)(2)(Tf2N)Ag-2(bet)(2)][Tf2N](3). The zwitterionic nature of the betaine ligand and the weakly coordinating ability of the bis(trifluoromethylsulfonyl)imide [Tf2N]- anion facilitates the incorporation of metal ions into oligonuclear and polynuclear metal complexes.

Solvent-free synthesis of metal complexes

Avoiding the use of solvents in synthesis can reduce environmental contamination and even be more convenient than using solvent-based synthesis. In this tutorial review we focus on recent research into the use of mechanochemistry ( grinding) to synthesise metal complexes in the absence of solvent. We include synthesis of mononuclear complexes, coordination clusters, spacious coordination cages, and 1-, 2- and 3-dimensional coordination polymers ( metal organic frameworks) which can even exhibit microporosity. Remarkably, in many cases, mechanochemical synthesis is actually faster and more convenient than the original solvent-based methods. Examples of solvent-free methods other than grinding are also briefly discussed, and the positive outlook for this growing topic is emphasised.

Speciation of Rare-Earth Metal Complexes in Ionic Liquids: A Multiple-Technique Approach

The dissolution process of metal complexes in ionic liquids was investigated by a multiple-technique approach to reveal the solvate species of the metal in solution. The task-specific ionic liquid betainium bis(trifluoromethylsulfonyl)imide ([Hbet][Tf2N]) is able to dissolve stoichiometric amounts of the oxides of the rare-earth elements. The crystal structures of the compounds [Eu-2(bet)(8)(H2O)(4)][Tf2N](6), [Eu-2(bet)(8)(H2O)(2)][Tf2N](6)center dot 2H(2)O, and [Y-2(bet)(6)(H2O)(4)][Tf2N](6) were found to consist of dimers. These rare-earth complexes are well soluble in the ionic liquids [Hbet][Tf2N] and [C(4)mim]- [Tf2N] (C(4)mim = 1-butyl-3-methylimidazolium). The speciation of the metal complexes after dissolution in these ionic liquids was investigated by luminescence spectroscopy, H-1, C-13, and Y-89 NMR spectroscopy, and by the synchrotron techniques EXAFS (extended X-ray absorption fine structure) and HEXS (high-energy X-ray scattering). The combination of these complementary analytical techniques reveals that the cationic dimers decompose into monomers after dissolution of the complexes in the ionic liquids. Deeper insight into the solution processes of metal compounds is desirable for applications of ionic liquids in the field of electrochemistry, catalysis, and materials chemistry.

Structure of Adenine on Metal Nanoparticles: pH Equilibria and Formation of Ag+ Complexes Detected by Surface-Enhanced Raman Spectroscopy

The SERS spectra of adenine recorded under a broad range of pH values and concentrations using both silver and gold colloids provided evidence for the existence of several distinct species. At high concentration (0.5-10 ppm), the spectra recorded between pH 1 and 11 showed only two distinct spectra, rather than the three forms that would be expected for a compound with two pK(a) values of 4.2 and 9.8. The spectra at neutral and alkaline pH were identical and assigned to the deprotonated form of adenine on the basis of DFT calculations, isotope shifts, and comparison with the normal Raman spectra of neutral and deprotonated adenine. The spectra at acidic pH were different, consistent with adenine protonation. Neutral adenine was not detected at any pH studied. At low adenine concentration (

Mer and fac isomerism in tris chelate diimine metal complexes

In this perspective, we highlight the issue of meridional (mer) and facial (fac) orientation of asymmetrical diimines in tris-chelate transition metal complexes. Diimine ligands have long been the workhorse of coordination chemistry, and whilst there are now good strategies to isolate materials where the inherent metal centered chirality is under almost complete control, and systematic methodologies to isolate heteroleptic complexes, the conceptually simple geometrical isomerism has not been widely investigated. In systems where the two donor atoms are significantly different in terms of the σ-donor and π-accepting ability, the fac isomer is likely to be the thermodynamic product. For the diimine complexes with two trigonal planar nitrogen atoms there is much more subtlety to the system, and external factors such as the solvent, lattice packing and the various steric considerations play a delicate role in determining the observed and isolable product. In this article we discuss the possibilities to control the isomeric ratio in labile systems, consider the opportunities to separate inert complexes and discuss the observed differences in their spectroscopic properties. Finally we report on the ligand orientation in supramolecular systems where facial coordination leads to simple regular structures such as helicates and tetrahedra, but the ability of the ligand system to adopt a mer orientation enables self-assembled structures of considerable beauty and complexity. 

The Unexpected Preference for the fac-Isomer with the Tris(5-ester-substituted-2,2′-bipyridine) Complexes of Ruthenium(II)

The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.