12 resultados para Loop Region


Relevância:

70.00% 70.00%

Publicador:

Resumo:

We report the identification of the promoter region of the Escherichia coli O7-specific lipopolysaccharide (LPS) gene cluster (wbEcO7). Typical -10 and -35 sequences were found to be located in the intervening region between galF and rlmB, the first gene of the wbEcO7 cluster. Data from RNase protection experiments revealed the existence of an untranslated leader mRNA segment of 173 bp, including the JUMPStart and two ops sequences. We characterized the structure of this leader mRNA by using the program Mfold and a combination of nested and internal deletions transcriptionally fused to a promoterless lac operon. Our results indicated that the leader mRNA may fold into a series of complex stem-loop structures, one of which includes the JUMPStart element. We have also found that one of the ops sequences resides on the predicted stem and the other resides on the loop region, and we confirmed that these sequences are essential for the RfaH-mediated regulation of the O polysaccharide cluster. A very similar stem-loop structure could be predicted in the promoter region of the LPS core operon encoding the waaQGPSBIJYZK genes. We observed another predicted stem-loop, located immediately downstream from the wbEcO7 transcription initiation site, which appeared to be involved in premature termination of transcription. This putative stem-loop is common to many other O polysaccharide gene clusters but is not present in core oligosaccharide genes. wbEcO7-lac transcriptional fusions in single copy numbers were also used to determine the effects of various environmental cues in the transcriptional regulation of O polysaccharide synthesis. No effects were detected with temperature, osmolarity, Mg2+ concentration, and drugs inducing changes in DNA supercoiling. We therefore conclude that the wbEcO7 promoter activity may be constitutive and that regulation takes place at the level of elongation of the mRNA in a RfaH-mediated manner.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

An octadecapeptide was isolated from the skin secretions of the dusky gopher frog (Rana sevosa) on the basis of histamine release from rat peritoneal mast cells. This peptide was purified to homogeneity by HPLC and found to have the following primary structure, YLKGCWTKSYPPKPCFSR, using both Edman degradation chemistry and peptide sequencing using high-resolution mass spectrometry (Q-TOF MS). The peptide, named peptide Tyrosine Arginine (pYR) shares 77.8% homology with peptide Leucine Arginine (pLR). The effects of the natural amidated peptide, non-amidated peptide and C-loop region of pYR on granulopoiesis and neutrophil apoptosis were investigated. All three analogues inhibited the early development of granulocyte macrophage colonies from bone marrow stem cells but did not induce apoptosis of the end stage granulocytes, the mature neutrophil. Thus, pYR is a novel member of an important and emerging new class of amphibian peptides with hemopoietic actions. (c) 2004 Elsevier Inc. All rights reserved.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The Solar Eclipse Corona Imaging System (SECIS) was used to record high-cadence observations of the solar corona during the total solar eclipse of 1999 August 11. During the 2 min 23.5 s of totality, 6364 images were recorded simultaneously in each of the two channels: a white light channel, and the Fe xiv (5303 Angstrom) 'green line' channel (T similar to2 MK). Here we report initial results from the SECIS experiment, including the discovery of a 6-s intensity oscillation in an active region coronal loop.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Magnetic neutral loop discharges (NLDs) can be operated at significantly lower pressures than conventional radio-frequency (rf) inductively coupled plasmas (ICPs). These low pressure conditions are favourable for technological applications, in particular anisotropic etching. An ICP–NLD has been designed providing excellent diagnostics access for detailed investigations of fundamental mechanisms. Spatially resolved Langmuir probe measurements have been performed in the plasma production region (NL region) as well as in the remote application region downstream from the NL region. Depending on the NL gradient two different operation modes have been observed exhibiting different opportunities for control of plasma uniformity. The efficient operation at comparatively low pressures results in ionization degrees exceeding 1%. In this regime neutral dynamics has to be considered and can influence neutral gas and process uniformity. Neutral gas depletion through elevated gas temperatures and high ionization rates have been quantified. At pressures above 0.1 Pa, gas heating is the dominant depletion mechanism. At lower pressures neutral gas is predominantly depleted through high ionization rates and rapid transport of ions by ambipolar diffusion along the magnetic field lines. Non-uniform profiles of the ionization rate can, therefore, result in localized neutral gas depletion and non-uniform processing. We have also investigated the electron dynamics within the radio-frequency cycle using phase resolved optical emission spectroscopy and Thomson scattering. In these measurements electron drift phenomena along the NL torus have been identified.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Spatial structures of plasma parameters in a radio-frequency inductively coupled magnetic neutral loop discharge are investigated under various parameter variations using spatially resolved Langmuir probe measurements. A strong coupling between the plasma production region, in the neutral loop (NL) plane, and the axially remote substrate region is observed. The two regions are connected through the separatrices and therefore, spatial profiles in the substrate region are strongly influenced by the plasma production region and the structure of the separatrices. The electron temperature in the plasma production region peaks in the centre of the NL while the maximum in electron density is shifted radially inwards due to diffusion. Details of the structures in both regions, the production region and the substrate region, are determined through the position of the NL and the gradient of the inhomogeneous magnetic field around the NL confinement region. Parameter combinations are found providing higher plasma densities and better uniformity than in common inductively coupled plasmas without applying an additional magnetic field. The uniformity can be further improved using temporal variations of the magnetic field structure.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A planar inductively coupled radio-frequency (rf) magnetic neutral loop discharge has been designed. It provides diagnostic access to both the main plasma production region as well as a remote plane for applications. Three coaxial coils are arranged to generate a specially designed inhomogeneous magnetic field structure with vanishing field along a ring in the discharge-the so-called neutral loop (NL). The plasma is generated by applying an oscillating rf electric field along the NL, induced through a four-turn, planar antenna operated at 13.56 MHz. Electron density and temperature measurements are performed under various parameter variations. Collisionless electron heating in the NL region allows plasma operation at comparatively low pressures, down to 10(-2) Pa, with a degree of ionization in the order of several per cent. Conventional plasma operation in inductive mode without applying the magnetic field is less efficient, in particular in the low pressure regime where the plasma cannot be sustained without magnetic fields.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Spectroscopic measurements of NOAA AR 10871, obtained with the Extreme Ultraviolet Normal Incidence Spectrograph (EUNIS) sounding rocket instrument on 2006 April 12, reveal velocity oscillations in the He II 303.8 angstrom emission line formed at T approximate to 5; 10(4) K. The oscillations appear to arise in a bright active region loop arcade about 25 '' wide which crosses the EUNIS slit. The period of these transition region oscillations is 26 +/- 4 s, coupled with a velocity amplitude of +/- 10 km s(-1), detected over four complete cycles. Similar oscillations are observed in lines formed at temperatures up to T approximate to 4; 10(5) K, but we find no evidence for the coupling of these velocity oscillations with corresponding phenomena in the corona. We interpret the detected oscillations as originating from an almost purely adiabatic plasma, and infer that they are generated by the resonant transmission of MHD waves through the lower active region atmospheres. Through the use of seismological techniques, we establish that the observed velocity oscillations display wave properties most characteristic of fast body global sausage modes.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Mammalian group-II phospholipases A2 (PLA2) of inflammatory fluids display bactericidal properties, which are dependent on their enzymatic activity. This study shows that myotoxins II (Lys49) and III (Asp49), two group-II PLA2 isoforms from the venom of Bothrops asper, are lethal to a broad spectrum of bacteria. Since the catalytically inactive Lys49 myotoxin II isoform has similar bactericidal effects to its catalytically active Asp49 counterpart, a bactericidal mechanism that is independent of an intrinsic PLA2 activity is demonstrated. Moreover, a synthetic 13-residue peptide of myotoxin II, comprising residues 115-129 (common numbering system) near the C-terminal loop, reproduced the bactericidal effect of the intact protein. Following exposure to the peptide or the protein, accelerated uptake of the hydrophobic probe N-phenyl-N-naphthylamine was observed in susceptible but not in resistant bacteria, indicating that the lethal effect was initiated on the bacterial membrane. The outer membrane, isolated lipopolysaccharide (LPS), and lipid A of susceptible bacteria showed higher binding to the myotoxin II-(115-129)-peptide than the corresponding moieties of resistant strains. Bacterial LPS chimeras indicated that LPS is a relevant target for myotoxin II-(115-129)-peptide. When heterologous LPS of the resistant strain was present in the context of susceptible bacteria, the chimera became resistant, and vice versa. Myotoxin II represents a group-II PLA2 with a direct bactericidal effect that is independent of an intrinsic enzymatic activity, but adscribed to the presence of a short cluster of basic/hydrophobic amino acids near its C-terminal loop.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Aims. We study the formation and evolution of a failed filament eruption observed in NOAA active region 11121 near the southeast
limb on November 6, 2010.
Methods. We used a time series of SDO/AIA 304, 171, 131, 193, 335, and 94 Å images, SDO/HMI magnetograms, as well as ROSA
and ISOON Hα images to study the erupting active region.
Results. We identify coronal loop arcades associated with a quadrupolar magnetic configuration, and show that the expansion and
cancellation of the central loop arcade system over the filament is followed by the eruption of the filament. The erupting filament
reveals a clear helical twist and develops the same sign of writhe in the form of inverse γ-shape.
Conclusions. The observations support the “magnetic breakout” process in which the eruption is triggered by quadrupolar reconnection
in the corona. We propose that the formation mechanism of the inverse γ-shape flux rope is the magnetohydrodynamic helical
kink instability. The eruption has failed because of the large-scale, closed, overlying magnetic loop arcade that encloses the active
region

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We investigate intensity variations and energy deposition in five coronal loops in active region cores. These were selected for their strong variability in the AIA/SDO 94 Å intensity channel. We isolate the hot Fe XVIII and Fe XXI components of the 94 Å and 131 Å by modeling and subtracting the "warm" contributions to the emission. HMI/SDO data allow us to focus on "inter-moss" regions in the loops. The detailed evolution of the inter-moss intensity time series reveals loops that are impulsively heated in a mode compatible with a nanoflare storm, with a spike in the hot 131 Å signals leading and the other five EUV emission channels following in progressive cooling order. A sharp increase in electron temperature tends to follow closely after the hot 131 Å signal confirming the impulsive nature of the process. A cooler process of growing emission measure follows more slowly. The Fourier power spectra of the hot 131 Å signals, when averaged over the five loops, present three scaling regimes with break frequencies near 0.1 min–1 and 0.7 min–1. The low frequency regime corresponds to 1/f noise; the intermediate indicates a persistent scaling process and the high frequencies show white noise. Very similar results are found for the energy dissipation in a 2D "hybrid" shell model of loop magneto-turbulence, based on reduced magnetohydrodynamics, that is compatible with nanoflare statistics. We suggest that such turbulent dissipation is the energy source for our loops

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Evidence has accumulated of high temperature (> 4 MK) coronal emission in active region cores that corresponds to structures in equilibrium. Other studies have found evidence of evolving loops. We investigate the EUV intensity and temperature variations of short coronal loops observed in the core of NOAA Active Region 11250 on 13 July 2011. The loops, which run directly between the AR opposite polarities, are first detectable in the 94Å band of Fe XVIII, implying an effective temperature ~ 7 MK. The low temperature component of the 94 Å signal is modeled in terms of a linear superposition of the 193 Å and 171 Å signals in order to separate the hot component. After identifying the loops we have used contemporaneous HMI observations to identify the corresponding inter-moss regions, and we have investigated their time evolution in six AIA EUV channels. The results can be separated into two classes. Group 1 (94Å, 335Å, 211Å) is characterized by hotter temperatures (~2-7 MK), and Group 2 (193Å, 171Å, 131Å) by cooler temperatures (0.4 - 1.6 MK). For Group 1 the intensity peaks in the 94Å channel are followed by maxima in the 335 Å channel with a time lag of ~8 min, suggestive of a cooling pattern with an exponential decay. While the 211Å maxima follow those in the 335 Å channel, there is no systematic relation which would indicate a progressive cooling process through the lower temperatures, as has been observed in other investigations. In Group 2 the signals in the 171 and 131Å channels track each other closely, and lag behind the 193Å. In the inter-moss region of the loop the peak temperature and peak emission measure have opposite trends. The hot 94Å brightenings occur in the central part of the loops with maximum temperatures ~7 MK. Subsequently the loops appear to fill with plasma with an emission measure compatible with the 193 Å signal and temperature in the range ~ 1.5-2 MK. Although the exact details of the time evolution are still under investigation, these non static loops show high levels of intermittency in the 94Å signal (please see poster "Intermittent and Scale-Invariant Intensity Fluctuations in Hot Coronal Loops," by Lawrence et al. in this session).