143 resultados para Inert material


Relevância:

100.00% 100.00%

Publicador:

Resumo:

All TAP micro-reactor configurations contain inert particles which are used so that the catalyst zone can be maintained under isothermal conditions. Even on

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Ultra-high molecular weight polyethylene (UHMWPE) is used for wear applications in total hip prostheses and total knee prostheses. Sterilisation of these prostheses is commonly by gamma-irradiation. This process creates reactive free radicals in the UHMWPE, greatly increasing its susceptibility to oxidative degradation. This study has investigated the influence of air and vacuum packaging on the properties of gamma-irradiated UHMWPE (GUR1050) following 3 years of shelf ageing. The findings indicate that vacuum packaging minimises oxidative degradation reactions that occur for UHMWPE during shelf ageing. However, gamma-irradiation of vacuum-packaged UHMWPE promotes a degree of cross-linking. It is proposed that this may enhance the wear performance of UHMWPE. Accelerated ageing studies indicate that 3 years of shelf ageing would also seem to reduce the susceptibility of gamma-irradiated UHMWPE to oxidative degradation upon removal from its vacuum packaging.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.