19 resultados para DSSC Ru(II) tetrazoli fotoassorbitori
Resumo:
This manuscript illustrates that the geometric arrangement of protein-binding groups around a ruthenium(II) core leads to dramatic differences in cytochrome c (cyt c) binding highlighting that it is possible to define synthetic receptors with shape complementarity to protein surfaces.
Resumo:
The new anionic functionalized aryldiamine ligands [2,6-(Me(2)NCH(2))(2)-4-R-C6H2](-) (R = Me(3)SiC=C, C6H5, Me(3)Si), formally derived from [2,6-(Me(2)NCH(2))(2)C6H3](-), have been prepared as their lithium compounds. The compound [Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2) crystallizes in the monoclinic space group C2/c (no. 15) with a = 13.1225(5), b = 13.5844(7), c = 15.9859(12) Angstrom, beta = 105.329(5)degrees, V = 3264.0(3)Angstrom(3), Z = 4. The structure refinement converged to R(1) = 0.0374 for 2037 observed reflections [F-o>4 sigma(F-o)] and wR(2) = 0.0922 for 2560 unique data. The organolithium compounds have been used in transmetalation reactions to give the corresponding functionalized organoruthenium(II) complexes [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl-+(-) (terpy = 2,2';6',2 ''-terpyridine). The Ru-II species with R = HC = C has also been synthesized.
Resumo:
The monoanionic ligand [C6H3(CH(2)NMe(2))(2)-2,6](-), a potentially terdentate N,C,N bonding system, has been employed to synthesize a series of new ruthenium(II) complexes [Ru{C6H3(CH(2)NMe(2))(2)-2,6}X(L)] (L = PPh(3) X = Cl (2a), I (2b); L = norbornadiene (nbd), X = Cl (4), eta(1)-OSO2CF3 (5)) and [Ru{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6',2 ''-terpyridine)]Cl (3). X-ray crystal structures of 2b and 3-5 have been determined, in which the N,C,N coordination geometry with respect to the metal center is found to differ considerably. In each complex the aryldiamine ligand is terdentate, eta(3)-N,C,N-bonded as a six electron donor system. However, depending on the other ligands in the Ru(II) coordination sphere, this ligand demonstrates considerable flexibility in adopting coordination geometries which range from meridional in 3 through pseudomeridional in 2b to pseudofacial in 4 and 5. In the structures of 4 and 5 significant distortions of the aryl ring, involving bending of the six-membered ring into a boatlike conformation, are found. The different combinations of the N,C,N ligand with sets of other ligands lead to a range of metal geometries, i.e. square pyramidal in 2b, octahedral in 3, and bicapped tetrahedral in 4 and 5.
Resumo:
Resonance Raman (RR) spectroscopy has been used to probe the interaction between dipyridophenazine (dppz) complexes of ruthenium(II), [Ru(L)(2)(dppz)](2+) (L = 1,10-phenanthroline (1) and 2,2-bipyridyl (2)), and calf-thymus DNA. Ground electronic state RR spectra at selected probe wavelengths reveal enhancement patterns which reflect perturbation of the dppz-centered electronic transitions in the UV-vis spectra in the presence of DNA. Comparison of the RR spectra recorded of the short-lived MLCT excited states of both complexes in aqueous solution with those of the longer-lived states of the complexes in the DNA environment reveals changes to excited state modes, suggesting perturbation of electronic transitions of the dppz ligand in the excited state as a result of intercalation. The most prominent feature, at 1526 cm(-1), appears in the spectra of both 1 and 2 and is a convenient marker band for intercalation. For 1, the excited state studies have been extended to the A and A enantiomers. The marker band appears at the same frequency for both but with different relative intensities. This is interpreted as reflecting the distinctive response of the enantiomers to the chiral environment of the DNA binding sites. The results, together with some analogous data for other potentially intercalating complexes, are considered in relation to the more general application of time-resolved RR spectroscopy for investigation of intercalative interactions of photoexcited metal complexes with DNA.
Resumo:
The novel ligand 4'-diferrocenylallcyne-2,2':6',2 ''-terpyridine (7; Fc-C C-Fc-tpy; tpy = terpyridyl; Fc = ferrocenyl) and its Ru2+ complexes 8-10 have been synthesized and characterized by single-crystal X-ray diffraction, cyclic voltammetry, and UV-vis and luminescence spectroscopy. Electrochemical data and UV absorption and emission spectra indicate that the insertion of an ethynyl group causes delocalization of electrons in the extended pi* orbitals. Cyclic voltammetric measurements of 7 show two successive reversible one-electron-oxidation processes with half-wave potentials of 0.53 and 0.78 V. The small variations of the E-1/2 values for the Fe2+/Fe3+ redox couples after the coordination of the Ru2+ ion suggest a weak interaction between the Ru2+ and Fe2+ centers. After insertion of an ethynyl group, UV-vis absorption spectra show a red shift of the absorption peak of the (1)[(d(pi)(Fe))(6)]->(1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT of the Ru2+ complexes. The Ru2+ complex 8 exhibits the strongest luminescence intensity (lambda(em)(max) 712 nm, Phi(em) = 2.63 x 10(-4), tau = 323 ns) relative to analogous ferrocene-based terpyridine Ru(II) complexes in H2O/CH3CN (4/1 v/v) solution.
Resumo:
Two novel alkynyl-bridged symmetric bis-tridentate ligands 1,2-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]-ferrocenyl)ethyne (3a; tpy-Fc-C C-Fc-tpy; Fc = ferrocenyl; tpy = terpyridyl) and 1,4-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]ferrocenyl)-1,3-butadiyne (3b; tpy-Fc-C C-C C-Fc-tpy) and their Ru2+ complexes 6a and 6b have been synthesized and characterized by cyclic voltammetry, UV-vis and luminescence spectroscopy, and in the case of 3b by single-crystal X-ray diffraction. Cyclic voltammograms of both compounds, 3a and 3b, display two severely overlapping ferrocene-based oxidative peaks with only one reductive peak. The redox behavior of 6a and 6b is dominated by the Ru2+/Ru3+ redox couple (E-1/2 from 1.33 to 1.34 V), the Fe2+/Fe3+ redox couples (E-1/2 from 0.46 to 0.80 V), and the tpy/tpy(-)/tpy(2-)redox couples (E-1/2 from -1.19 to -1.48 V). The UV-vis spectra of 6a and 6b show absorption bands assigned to the (1)[(d(pi)(Fe))(6)] -> (1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT transition at similar to 555 nm. Complexes 6a and 6b are luminescent in H2O-CH3CN (4 : 1, v/v) solution at room temperature, and 6b exhibits the strongest luminescence intensity (lambda(em)(max): 710 nm, Phi(em): 2.28 x 10(-4), tau: 358 ns) relative to analogous ferrocene-based bis(terpyridine) Ru(II) complexes reported so far.
Resumo:
Compounds that change their absorption and/or emission properties in the presence of a target ion or molecule have been studied for many years as the basis for optical sensing. Within this group of compounds, a variety of organometallic complexes have been proposed for the detection of a wide range of analytes such as cations (including H+), anions, gases (e.g. O2, SO2, organic vapours), small organic molecules, and large biomolecules (e.g. proteins, DNA). This chapter focuses on work reported within the last few years in the area of organometallic sensors. Some of the most extensively studied systems incorporate metal moieties with intense long-lived metal-to-ligand charge transfer (MLCT) excited states as the reporter or indicator unit, such as fac-tricarbonyl Re(I) complexes, cyclometallated Ir(III) species, and diimine Ru(II) or Os(II) derivatives. Other commonly used organometallic sensors are based on Pt-alkynyls and ferrocene fragments. To these reporters, an appropriate recognition or analyte-binding unit is usually attached so that a detectable modification on the colour and/or the emission of the complex occurs upon binding of the analyte. Examples of recognition sites include macrocycles for the binding of cations, H-bonding units selective to specific anions, and DNA intercalating fragments. A different approach is used for the detection of some gases or vapours, where the sensor's response is associated with changes in the crystal packing of the complex on absorption of the gas, or to direct coordination of the analyte to the metal centre.
Resumo:
New air-stable ruthenium(II) complexes that contain the aryldiamine ligand [C6H3(CH2-NMe2)(2)-2,6](-) (NCN) are described. These complexes are [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(6)-C10H14)] (2; C10H14 = p-cymene = C6H4Me-Pr-i-4), [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,6}(eta(5)-C5H5)(PPh3)] (5), and their isomeric forms [RuCl{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(6)-C10H14)] (3) and [Ru{eta(2)-C,N-C6H3(CH2NMe2)(2)-2,4}(eta(5)-C5H5)(PPh3)] (6), respectively. Complex 2 has been prepared from the reaction of [Li(NCN)](2) with [RuCl2(eta(6)-C10H14)](2), whereas complex 5 has been prepared by the treatment of [RuCl{eta(3)-N,C,N-C6H3(CH2NMe2)(2)-2,6}(PPh3)] (4) with [Na(C5H5)](n). Both 2 and 5 are formally 18-electron ruthenium(II) complexes in which the monoanionic potentially tridentate coordinating ligand NCN is eta(2)-C,N-bonded, In solution (halocarbon solvent at room temperature or in aromatic solvents at elevated temperature), the intramolecular rearrangements of 2 and 5 afford complexes 3 and 6, respectively. This is a result of a shift of the metal-C-aryl bond from position-1 to position-3 on the aromatic ring of the NCN ligand. The mechanism of the isomerization is proposed to involve a sequence of intramolecular oxidative addition and reductive elimination reactions of both aromatic and aliphatic C-H bonds. This is based on results from deuterium labeling, spectroscopic studies, and some kinetic experiments. The mechanism is proposed to contain fully reversible steps in the case of 5, but a nonreversible step involving oxidative addition of a methyl NCH2-H bond in the case of 2. The solid-state structures of complexes 2, 3, 5, and 6 have been determined by single-crystal X-ray diffraction. A new dinuclear 1,4-phenylene-bridged bisruthenium(II) complex, [1,4-{RuCl(eta(6)-C10H14)}(2){C-6(CH2NMe2)(4)-2,3,5,6-C,N,C',N'}] (9) has also been prepared from the dianionic ligand [C-6(CH2NMe2)(4)-2,3,5,6](2-) (C2N4). The C2N4 ligand is in an eta(2)-C,N-eta(2)-C',N'-bis(bidentate) bonding mode. Compound 9 does not isomerize in solution (halocarbon solvent), presumably because of the absence of an accessible C-aryl-H bond. Complex 9 could not be isolated in an analytically pure form, probably because of its high sensitivity to air and very low solubility, which precludes recrystallization.
Resumo:
The synthesis of a number of new 2,2'-bipyridine ligands, functionalized with bulky ester side groups is reported (L2 - L8). Their reaction with [Ru(DMSO)4Cl2] gives rise to tris-chelate ruthenium(II) metal complexes which show an unusually high proportion of the fac-isomer, as judged by 1H NMR following conversion to the ruthenium(II) complex of 2,2'-bipyridine-5-carboxylic acid methyl ester (L1). The initial reaction appears to have thermodynamic control with the steric bulk of the ligands causing the third ligand to be labile under the reaction conditions used, giving rise to disappointing yields and allowing rearrangement to the more stable facial form. DFT studies indicate that this does not appear to be as a consequence of a metal centered electronic effect. The two isomers of [Ru(L1)3](PF6)2 were separated into the two individual forms using silica preparative plate chromatographic procedures, and the photophysical characteristics of the two forms compared. The results appear to indicate that there is no significant difference in both their room temperature electronic absorption and emission spectra or their excited state lifetimes at 77K.
Resumo:
Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.
Resumo:
A quantitative approach is used to understand the chain growth mechanism in FT synthesis on the Ru, Fe, Rh, and Re surfaces. The C-C coupling reactions are extensively calculated on the stepped metal surfaces. Combining the coupling barriers and reactant stabilities, we investigate the reaction rates of all possible C, + C-1 coupling pathways on the metal surfaces. It is found that (i) all the transition-state structures are similar on these surfaces, while some coupling barriers are very different; (ii) the dominant chain growth pathways on these surfaces are different: C + CH and CH + CH on Rh and Ru surfaces, C + CH3 on Fe surface, and C + CH on Re surface. The common features of the major coupling reactions together with those on the Co surface are also discussed.
Resumo:
The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.
Resumo:
A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.