57 resultados para DIMETHYL FORMAMIDE


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Colourless crystals of [Hg-2(Mmt)(Dmt)(2)](NO3)(H2O) were obtained from a reaction of mercuric nitrate with nionomethyl- and dimethyl-1,2.4-triazolate (Mmt(-) and Dmt(-), respectively). In the crystal structure (monoclinic, C2/c (no. 15), a = 2579.4(4) b = 1231.1(2), c = 1634.8(2) pm, beta = 128.32(1)degrees V = 4073.3(11).10(6).pm(3): Z = 8, R-1 [I-0 > 2 sigma(I-0)]: 0.0355), half of the mercuric ions are essentially two-coordinate (Hg-N: 210-215 pm), the other half are tetrahedrally surrounded by N-donor atoms (Hg-N: 221, 225 pm) of the Mmt(-) and Dmt(-) anions. These three-N ligands construct a three-dimensional framework.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Colourless single crystals of [Ag-3(Dat)(2)](NO3)(3) were obtained from a reaction of silver(l) nitrate and 3,5-dimethyl-4-amino-1,2,4-triazole (Dat). In the crystal structure (orthorhombic, Fdd2, Z = 8, a = 1100.1(2), b = 3500.3(2), c = 1015.4(3) pm, R, = 0.0434) there are two crystallographically non-equivalent silver sites in a one (Ag1) to two ratio (Ag2). Both resemble linear N-Ag-N coordination although angles are 163 degrees and 144 degrees, respectively Each Dat ligand coordinates with the two ring nitrogen atoms at 216 to 219 pm and with one amino-nitrogen atom at 229 pro. According to the composition [Ag-3(Dat)(2)](3+) = [(Dat)Ag-3/2](3+), a polymeric structure is built with all Ag+ ions bridging.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Colourless single crystals of [Hg(CF3)(2)(Pur)](4) and [Hg(CF3)(2)(Dat)](2) were obtained from aqueous and etheric solutions of the respective components Purine, (imidazo[4,5-d]pyrimidine, Pur), 3,5-dimethyl-4 '-amino-triazole (Dat) and bis(trifluoromethyl)mercury(II), Hg(CF3)(2). [Hg(CF3)(2)(Pur)](4) crystallizes with the tetragonal system (P-4, Z = 8, a = 1486.8(2), c = 1026.2(l) pm, R-all = 0.0657) with tetrameric molecules consisting of four purine molecules bridged by slightly bent Hg(CF3)2 molecules forming a cage with the CF3 ligands surrounding this cage. The two modifications of [Hg(Dat)(CF3)2]2 (1: 170 K, triclinic, P-1, Z = 2, a 814.9(2), b = 845.4(2), c = 968.4(3) pm, alpha = 106.55(2)degrees, beta= 103.41(2)degrees, gamma = 110.79(2)degrees, R-all = 0.1189; II: monoclinic, P2(1)/c, Z = 8, a = 879.8(2), b = 1731.0(3), c = 1593.9(3) pm, beta = 106.89(2)degrees, R-all = 0.1199) both contain dimeric molecules that are stacked parallel to one crystal axis to strands which are arranged in a parallel fashion in I and rotated against each other in 11 by 110 degrees. In both, the tetrameric [Hg(CF3)(2)(Pur)](4) and the dimeric [Hg(CF3)(2)(Dat)](2) the Hg(CF3)(2) molecules are slightly bent (around 167 and 170 degrees) and rather weakly attached to the N-donor ligands Pur and Dat with Hg-N distances around 272 pm, although in both cases the Hg atoms bridge between two ligand molecules.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

[Pt(Me(2)bipy)Cl-2](Me(2)bipy = 4,4'-dimethyl-2,2'-bipyridine) and HC=CC6H4-4-R react in the presence of diisopropylamine and CuI as catalyst to give the platinum bis-acetylides [Pt(Me(2)bipy)(C=CC6H4-4-R)(2)] R = H, Me, NO2. Initial spectroscopic, electrochemical and reactivity studies are presented. (C) 1997 Elsevier Science S.A.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Selected Bronsted acidic ionic liquids were tested as homogeneous catalysts for the dehydration of methanol to dimethyl ether. Ionic liquids incorporating an alkanesulfonic acid as a part of the cation, a complex acidic anion, [A(2)H](-), or both, proved to be good catalysts for this process, providing high conversions and selectivities. Homogeneous catalysis in the liquid state represents a novel approach to dimethyl ether synthesis.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A substantial acceleration of the Baylis-Hillman reaction between cyclohexenone and benzaldehyde has been observed when the reaction is conducted in water. Several different amine catalysts were tested, and as with reactions conducted in the absence of solvent, 3-hydroxyquinuclidine was found to be the optimum catalyst in terms of rate. The reaction has been extended to other aldehyde electrophiles including pivaldehyde. Attempts to extend this work to acrylates was only partially successful as rapid hydrolysis of methyl and ethyl acrylates occurred under the base-catalyzed and water-promoted conditions. However, tert-butyl acrylates were sufficiently stable to couple with relatively reactive electrophiles. Further studies on the use of polar solvents revealed that formamide also provided significant acceleration and the use of 5 equiv of formamide (optimum amount) gave faster rates than reactions conducted in water. Using formamide, further acceleration was achieved in the presence of Yb(OTf)(3) (5 mol %). The scope of the new conditions was tested with a range of Michael acceptors and benzaldehyde and with a range of electrophiles and ethyl acrylate. The origin of the rate acceleration is discussed.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Dimethyl ether (DME) is amongst one of the most promising alternative, renewable and clean fuels being considered as a future energy carrier. In this study, the comparative catalytic performance of γ-Al2O3 prepared from two common precursors (aluminum nitrate (AN) and aluminum chloride (AC)) is presented. The impact of calcination temperature was evaluated in order to optimize both the precursor and pre-treatment conditions for the production of DME from methanol in a fixed bed reactor. The catalysts were characterized by TGA, XRD, BET and TPD-pyridine. Under reaction conditions where the temperature ranged from 180 °C to 300 °C with a WHSV = 12.1 h−1 it was found that all the catalysts prepared from AN(η-Al2O3) showed higher activity, at all calcination temperatures, than those prepared from AC(γ-Al2O3). In this study the optimum catalyst was produced from AN and calcined at 550 °C. This catalyst showed a high degree of stability and had double the activity of the commercial γ-Al2O3 or 87% of the activity of commercial ZSM-5(80) at 250 °C.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Herein we investigate the use of CuO-ZnO-Al2O3 (CZA) with different solid acid catalysts (NH(4)ZSM-5. HZSM-5 or gamma-Al2O3) for the production of dimethyl ether from syngas. It was found that of the solid acids, which are necessary for the dehydration function of the admixed system, the CZA/HZSM-5 bifunctional catalyst with a 0.25 acid fraction showed high stability over a continuous period of 212 h.

As this particular system was observed to loose around 16.2% of its initial activity over this operating period this study further investigates the CZA/HZSM-5 bifunctional catalyst in terms of its deactivation mechanisms. TPO investigations showed that the catalyst deactivation was related to coke deposited on the metallic sites: interface between the metallic sites and the support near the metal-support: and on the support itself. 

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The influx of arsenate, arsenite and dimethyl arsinic acid (DMA) were studied in 7-day-old excised maize roots (Zea mays L.), and then related to arsenate, arsenite and DMA toxicity. Arsenate, arsenite and DMA influx was all found concentration dependent with significant genotypic differences for arsenite and DMA. Arsenate influx in phosphate starved plants best fitted the four-parameter Michaelis-Menten model corresponding to an additive high and low affinity uptake system, while the uptake of phosphate replete plants followed the two parameter model of Michaelis-Menten kinetics. Arsenite influx was well described by the two parameter model of 'Michaelis-Menten' kinetics. DMA influx was comprised of linear phase and a hyperbolic phase. DMA influx was much lower than that for arsenite and arsenate. Arsenate and DMA influx decreased when phosphate was given as a pre-treatment as opposed to phosphate starved plants. The +P treatment tended to decrease influx by 50% for arsenate while this figure was 90% for DMA. Arsenite influx increasing slightly at higher arsenite concentrations in P starved plants but at lower arsenite concentrations, there was little or no difference in arsenite uptake. Low toxicity was found for DMA on maize compared with arsenate and arsenite and the relative toxicity of arsenic species was As(V) > As(III) >> DMA. © 2008 Springer Science+Business Media B.V.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The effects of diphosphine flexibility and bite angle on the structures and luminescence properties of Au(I) complexes have been investigated. A range of diphosphines based on heteroaromatic backbones [bis(2-diphenylphosphino)phenylether (dpephos), 9,9-dimethyl-4,5-bis(diphenylphosphino)xanthene (xantphos), and 4,6-bis(diphenylphosphino)dibenzofuran (dbfphos)] has been used to prepare mono- and digold derivatives. A clear relationship between the presence of aurophilic contacts and the emission properties of dinuclear complexes has been observed, with one of the complexes studied, [Au(2)Cl(2)(micro-xantphos)], exhibiting luminescence thermochromism.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Ab initio molecular dynamics simulations have been performed for the first time on the room-temperature organic ionic liquid dimethyl imidazolium chloride [DMIM][Cl] using density functional theory. The aim is to compare the local liquid structure with both that obtained from two different classical force fields and from neutron scattering experiments. The local structure around the cation shows significant differences compared to both the classical calculations and the neutron results. In particular, and unlike in the gas-phase ion pair, chloride ions tend to be located near a ring C-H proton in a position suggesting hydrogen bonding. The results are used to suggest ways in which the classical potentials may be improved.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Epoxides and phosphites are often used as additives to stabilize the properties of polymers, including bisphenol A polycarbonate (BPA-PC). We describe density functional (DF) calculations of the reactions of cyclohexene oxide (CHO, cyclohexane epoxide) and phosphites with chain segments of BPA-PC, with the aim of identifying possible reaction paths and energy barriers. The reactions of CHO with the OH-terminated PC chains and with the carbonate group are exothermic, although there is an energy barrier in each case of more than 10 kcal/mol. A comparison of results for different CHO isomers demonstrates the importance of steric effects. The reactions between the same groups of the PC chain and the phosphites 2-[2,4-bis(tert-butyl)phenoxy]-5,5-dimethyl-1,3,2-dioxaphosphorinane] (BPDD) and trimethyl phosphite (TMP), and their phosphonate isomers are characterized by large energy barriers.