150 resultados para Accident insurance agents.


Relevância:

80.00% 80.00%

Publicador:

Resumo:

BACKGROUND: Published work assessing psychosocial stress (job strain) as a risk factor for coronary heart disease is inconsistent and subject to publication bias and reverse causation bias. We analysed the relation between job strain and coronary heart disease with a meta-analysis of published and unpublished studies. METHODS: We used individual records from 13 European cohort studies (1985-2006) of men and women without coronary heart disease who were employed at time of baseline assessment. We measured job strain with questions from validated job-content and demand-control questionnaires. We extracted data in two stages such that acquisition and harmonisation of job strain measure and covariables occurred before linkage to records for coronary heart disease. We defined incident coronary heart disease as the first non-fatal myocardial infarction or coronary death. FINDINGS: 30?214 (15%) of 197?473 participants reported job strain. In 1·49 million person-years at risk (mean follow-up 7·5 years [SD 1·7]), we recorded 2358 events of incident coronary heart disease. After adjustment for sex and age, the hazard ratio for job strain versus no job strain was 1·23 (95% CI 1·10-1·37). This effect estimate was higher in published (1·43, 1·15-1·77) than unpublished (1·16, 1·02-1·32) studies. Hazard ratios were likewise raised in analyses addressing reverse causality by exclusion of events of coronary heart disease that occurred in the first 3 years (1·31, 1·15-1·48) and 5 years (1·30, 1·13-1·50) of follow-up. We noted an association between job strain and coronary heart disease for sex, age groups, socioeconomic strata, and region, and after adjustments for socioeconomic status, and lifestyle and conventional risk factors. The population attributable risk for job strain was 3·4%. INTERPRETATION: Our findings suggest that prevention of workplace stress might decrease disease incidence; however, this strategy would have a much smaller effect than would tackling of standard risk factors, such as smoking. FUNDING: Finnish Work Environment Fund, the Academy of Finland, the Swedish Research Council for Working Life and Social Research, the German Social Accident Insurance, the Danish National Research Centre for the Working Environment, the BUPA Foundation, the Ministry of Social Affairs and Employment, the Medical Research Council, the Wellcome Trust, and the US National Institutes of Health.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The relative sensitivity of neoplastic cells to DNA damaging agents is a key factor in cancer therapy. In this paper, we show that pretreatment of Burkitt's lymphoma cell lines expressing the c-met protooncogene with hepatocyte growth factor (HGF) protects them from death induced by DNA damaging agents commonly used in tumour therapy. This protection was observed in assays based on morphological assessment of apoptotic cells and DNA fragmentation assays. The protection was dose- and time-dependent — maximal protection requiring pre-incubation with 100 ng/ml HGF for 48 h. Western blotting analysis and flow cytometric studies revealed that HGF inhibited doxorubicin- and etoposide-induced decreases in the levels of the anti-apoptotic proteins Bcl-XL, and to a lesser extent Bcl-2, without inducing changes in the pro-apoptotic Bax protein. Overall, these studies suggest that the accumulation of HGF within the microenvironment of neoplastic cells may contribute to the development of a chemoresistant phenotype.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.