Improved diffusive gradients in thin films (DGT) measurement of total dissolved inorganic arsenic in waters and soils using a hydrous zirconium oxide binding layer

Abstract Image

A high-capacity diffusive gradients in thin films (DGT) technique has been developed for measurement of total dissolved inorganic arsenic (As) using a long shelf life binding gel layer containing hydrous zirconium oxide (Zr-oxide). Both As(III) and As(V) were rapidly accumulated in the Zr-oxide gel and could be quantitatively recovered by elution using 1.0 M NaOH for freshwater or a mixture of 1.0 M NaOH and 1.0 M H2O2 for seawater. DGT uptake of As(III) and As(V) increased linearly with deployment time and was independent of pH (2.0–9.1), ionic strength (0.01–750 mM), the coexistence of phosphate (0.25–10 mg P L–1), and the aging of the Zr-oxide gel up to 24 months after production. The capacities of the Zr-oxide DGT were 159 μg As(III) and 434 μg As(V) per device for freshwater and 94 μg As(III) and 152 μg As(V) per device for seawater. These values were 5–29 times and 3–19 times more than those reported for the commonly used ferrihydrite and Metsorb DGTs, respectively. Deployments of the Zr-oxide DGT in As-spiked synthetic seawater provided accurate measurements of total dissolved inorganic As over the 96 h deployment, whereas ferrihydrite and Metsorb DGTs only measured the concentrations accurately up to 24 and 48 h, respectively. Deployments in soils showed that the Zr-oxide DGT was a reliable and robust tool, even for soil samples heavily polluted with As. In contrast, As in these soils was underestimated by ferrihydrite and Metsorb DGTs due to insufficient effective capacities, which were likely suppressed by the competing effects of phosphate.

The conserved Helix C region in the superfamily of interferon-a/interleukin-10-related cytokines corresponds to a high-affinity binding site for the HSP70 chaperone DnaK.

HSP70 chaperones mediate protein folding by ATP-dependent interaction with short linear peptide segments that are exposed on unfolded proteins. The mode of action of the Escherichia coli homolog DnaK is representative of all HSP70 chaperones, including the endoplasmic reticulum variant BiP/GRP78. DnaK has been shown to be effective in assisting refolding of a wide variety of prokaryotic and eukaryotic proteins, including the -helical homodimeric secretory cytokine interferon- (IFN-). We screened solid-phase peptide libraries from human and mouse IFN- to identify DnaK-binding sites. Conserved DnaK-binding sites were identified in the N-terminal half of helix B and in the C-terminal half of helix C, both of which are located at the IFN- dimer interface. Soluble peptides derived from helices B and C bound DnaK with high affinity in competition assays. No DnaK-binding sites were found in the loops connecting the -helices. The helix C DnaK-binding site appears to be conserved in most members of the superfamily of interleukin (IL)-10-related cytokines that comprises, apart from IL-10 and IFN-, a series of recently discovered small secretory proteins, including IL-19, IL-20, IL-22/IL-TIF, IL-24/MDA-7 (melanoma differentiation-associated gene), IL-26/AK155, and a number of viral IL-10 homologs. These cytokines belong to a relatively small group of homodimeric proteins with highly interdigitated interfaces that exhibit the strongly hydrophobic character of the interior core of a single-chain folded domain. We propose that binding of DnaK to helix C in the superfamily of IL-10-related cytokines may constitute the hallmark of a novel conserved regulatory mechanism in which HSP70-like chaperones assist in the formation of a hydrophobic dimeric "folding" interface.

Synthesis and Binding of Stable Bisubstrate Ligands for Phosphoglycerate Kinase

Stable bisubstrate ligands of phosphoglycerate kinase (PGK) have been synthesised with AMP or ADP conjugated to hydrolytically-stable, symmetrical analogues of 1,3-bisphosphoglycerate and their binding to yeast PGK evaluated. Their Kds decrease with net negative charge, with a penta-anionic analogue 7 showing highest affinity - in accordance with its approximation to the transition state for the reaction catalysed by PGK.

A possible model of benzimidazole binding to beta-tubulin disclosed by invoking an inter-domain movement.

Although it is well established that benzimidazole (BZMs) compounds exert their therapeutic effects through binding to helminth beta-tubulin and thus disrupting microtubule-based processes in the parasites, the precise location of the benzimidazole-binding site on the beta-tubulin molecule has yet to be determined. In the present study, we have used previous experimental data as cues to help identify this site. Firstly, benzimidazole resistance has been correlated with a phenylalanine-to-tyrosine substitution at position 200 of Haemonchus contortus beta-tubulin isotype-I. Secondly, site-directed mutagenesis studies, using fungi, have shown that other residues in this region of the protein can influence the interaction of benzimidazoles with beta-tubulin. However, the atomic structure of the alphabeta-tubulin dimer shows that residue 200 and the other implicated residues are buried within the protein. This poses the question: how might benzimidazoles interact with these apparently inaccessible residues? In the present study, we present a mechanism by which those residues generally believed to interact with benzimidazoles may become accessible to the drugs. Furthermore, by docking albendazole-sulphoxide into a modelled H. contortus beta-tubulin molecule we offer a structural explanation for how the mutation conferring benzimidazole resistance in nematodes may act, as well as a possible explanation for the species-specificity of benzimidazole anthelmintics.

Metastasis-inducing DNA Regulates the Expression of the Osteopontin Gene by Binding the Transcription Factor Tcf-4

Small 1,000-bp fragments of genomic DNA obtained from human malignant breast cancer cell lines when transfected into a benign rat mammary cell line enhance transcription of the osteopontin gene and thereby cause the cells to metastasize in syngeneic rats. To identify the molecular events underlying this process, transient cotransfections of an osteopontin promoter-reporter construct and fragments of one metastasis-inducing DNA (Met-DNA) have identified the active components in the Met-DNA as the binding sites for the T-cell factor (Tcf) family of transcription factors. Incubation of cell extracts with active DNA fragments containing the sequence CAAAG caused retardation of their mobilities on polyacrylamide gels, and Western blotting identified Tcf-4, beta-catenin, and E-cadherin in the relevant DNA complexes in vitro. Transfection of an expression vector for Tcf-4 inhibited the stimulated activity of the osteopontin promoter-reporter construct caused by transiently transfected active fragments of Met-DNA or permanently transfected Met-DNA. This stimulated activity of the osteopontin promoter-reporter construct is accompanied by an increase in endogenous osteopontin mRNA but not in fos or actin mRNAs in the transfected cells. Permanent transfection of the benign rat mammary cell line with a 20-bp fragment from the Met-DNA containing the Tcf recognition sequence CAAAG caused an enhanced permanent production of endogenous osteopontin protein in vitro and induced the cells to metastasize in syngeneic rats in vivo. The corresponding fragment without the CAAAG sequence was without either effect. Therefore, the regulatory effect of the C9-Met-DNA is exerted, at least in part, by a CAAAG sequence that can sequester the endogenous inhibitory Tcf-4 and thereby promote transcription of osteopontin, the direct effector of metastasis in this system.

Properties of SEPT9 Isoforms and the requirement for GTP binding

Members of the evolutionarily conserved septin family of genes are emerging as key components of several cellular processes including membrane trafficking, cytokinesis, and cell-cycle control events. SEPT9 has been shown to have a complex genomic architecture, such that up to 15 different isoforms are possible by the shuffling of five alternate amino termini and three alternate carboxy termini. Genomic and transcriptional alterations of SEPT9 have been associated with neoplasia. The present study has used a Sept9-specific antibody to determine the pattern of isoform expression in a range of tumour cell lines. Western blot analysis indicated considerable variation in the relative amounts and isoform content of Sept9. Immunofluorescence studies showed a range of patterns of cytoplasmic localization ranging from mainly particulate to mainly filamentous. Expression constructs were also generated for each amino terminal isoform to investigate the patterns of localization of individual isoforms and the effects on cells of ectopic expression. The present study shows that the epsilon isoform appears filamentous in this overexpression system while the remaining isoforms are particulate and cytoplasmic. Transient transfection of individual constructs into tumour cell lines results in cell-cycle perturbation with a G2/M arrest and dramatic growth suppression, which was greatest in cell lines with the lowest amounts of endogenous Sept9. Similar phenotypic observations were made with GTP-binding mutants of all five N-terminal variants of Sept9. However, dramatic differences were observed in the kinetics of accumulation of wild-type versus mutant septin protein in transfected cells. In conclusion, the present study shows that the expression patterns of Sept9 protein are very varied in a panel of tumour cell lines and the functional studies are consistent with a model of septin function as a component of a molecular scaffold that contributes to diverse cellular functions. Alterations in the levels of Sept9 protein by overexpression of individual isoforms can clearly perturb cellular behaviour and may thus provide a mechanistic explanation for observations of deranged septin expression in neoplasia. Copyright © 2004 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.