The application of a novel fluidised photo reactor under UV-Visible and natural solar irradiation in the photocatalytic generation of hydrogen

With advancements in the development of visible light responsive catalysts for H2 production frequently being reported, photocatalytic water splitting has become an attractive method as a potential ‘solar fuel generator’. The development of novel photo reactors which can enhance the potential of such catalyst, however, is rarely reported. This is particularly important as many reactor configurations are mass transport limited, which in term limits the efficiency of more effective photocatalysts in larger scale applications. This paper describes the performance of a novel fluidised photo reactor for the production of H2 over two catalysts under UV-Visible light and natural solar illumination. Catalysts Pt-C3N4 and NaTaO3.La were dispersed in the reactor and the rate of H2 was determined by GC-TCD analysis of the gas headspace. The unit was an annular reactor constructed from stainless steel 316 and quartz glass with a propeller located in the base to control fluidisation of powder catalysts. Reactor properties such as propeller rotational speed were found to enhance the photo activity of the system through the elimination of mass transport limitations and increasing light penetration. The optimum conditions for H2 evolution were found to be a propeller rotational speed of 1035 rpm and 144 W of UV-Visible irradiation, which produced a rate of 89 µmol h-1 g-1 over Pt-C3N4. Solar irradiation was provided by the George Ellery Hale Solar Telescope, located at the California Institute of Technology.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Rational design of a dual-mode optical and chemical prodrug

Purpose. The purpose of this study is to demonstrate the rational design and behaviour of the first dual mode optical and chemical prodrug, exemplified by an acetyl salicylic acid-based system. Methods. A cyclic 1,4-benzodioxinone prodrug was synthesised by reaction of 3,5-dimethoxybenzoin and acetyl salicoyl chloride with pyridine. After purification by column chromatography and recrystallization, characterization was achieved using infrared and NMR spectroscopies, mass spectrometry, elemental analysis and single crystal X-ray diffraction. Light-triggered drug liberation was characterised via UV-visible spectroscopy following low-power 365 nm irradiation for controlled times. Chemical drug liberation was characterised via UV-visible spectroscopy in pH 5.5 solution. Results. The synthetic method yielded pure prodrug, with full supporting characterisation. Light-triggered drug liberation proceeded at a rate of 8.30 10j2 sj1, while chemical, hydrolytic liberation proceeded independently at 1.89 10j3 sj1. The photochemical and hydrolytic reactions were both quantitative. Conclusions. This study demonstrates the first rational dual-mode optical and chemical prodrug, using acetyl salicylic acid as a model, acting as a paradigm for future dual-mode systems. Photochemical drug liberation proceeds 44 times faster than chemical liberation, suggesting potential use in drug-eluting medical devices where an additional burst of drug is required at the onset of infection.

Neighboring Group-Controlled Hydrolysis: Towards “Designer” Drug Release Biomaterials

To give the first demonstration of neighboring group-controlled drug delivery rates, a series of novel, polymerizable ester drug conjugates was synthesized and fully characterized. The monomers are suitable for copolymerization in biomaterials where control of drug release rate is critical to prophylaxis or obviation of infection. The incorporation of neighboring group moieties differing in nucleophilicity, geometry, and steric bulk in the conjugates allowed the rate of ester hydrolysis, and hence drug liberation, to be rationally and widely controlled. Solutions (2.5 x 10-5 mol dm-3) of ester conjugates of nalidixic acid incorporating pyridyl, amino, and phenyl neighboring groups hydrolyzed according to first-order kinetics, with rate constants between 3.00 ( 0.12 10-5 s -1 (fastest) and 4.50 ( 0.31 10- 6 s-1 (slowest). The hydrolysis was characterized using UV-visible spectroscopy. When copolymerized with poly(methyl methacrylate), free drug was shown to elute from the resulting materials, with the rate of release being controlled by the nature of the conjugate, as in solution. The controlled molecular architecture demonstrated by this system offers an attractive class of drug conjugate for the delivery of drugs from polymeric biomaterials such as bone cements in terms of both sustained, prolonged drug release and minimization of mechanical compromise as a result of release. We consider these results to be the rationale for the development of 'designer' drug release biomaterials, where the rate of required release can be controlled by predetermined molecular architecture.

Identical extraction behavior and coordination of trivalent or hexavalent f-element cations using ionic liquid and molecular solvents

The extraction of both UO22+ and trivalent lanthanide and actinide ions (Am3+, Nd3+, Eu3+) by dialkylphosphoric or dialkylphosphinic acids from aqueous solutions into the ionic liquid, 1-decyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide has been studied and compared to extractions into dodecane. Radiotracer partitioning measurements show comparable patterns of distribution ratios for both the ionic liquid/aqueous and dodecane/aqueous systems, and the limiting slopes at low acidity indicate the partitioning of neutral complexes in both solvent systems. The metal ion coordination environment, elucidated from EXAFS and UV-visible spectroscopy measurements, is equivalent in the ionic liquid and dodecane solutions with coordination of the uranyl cation by two hydrogen-bonded extractant dimers, and of the trivalent cations by three extractant dimers. This is the first definitive report of a system where both the biphasic extraction equilibria and metal coordination environment are the same in an ionic liquid and a molecular organic solvent.

Effect of roasting on the antioxidant activity of coffee brews

Colombian Arabica coffee beans were roasted to give light, medium, and dark samples. Their aqueous extracts were analyzed by gel filtration chromatography, UV-visible spectrophotometry, capillary electrophoresis, and the ABTS(.+) assay. A progressive decrease in antioxidant activity (associated mainly with chlorogenic acids in the green beans) with degree of roasting was observed with the simultaneous generation of high (HMM) and low molecular mass (LMM) compounds possessing antioxidant activity. Maximum antioxidant activity was observed for the medium-roasted coffee; the dark coffee had a lower antioxidant activity despite the increase in color. Analysis of the gel filtration chromatography fractions showed that the LMM fraction made a greater contribution to total antioxidant activity than the HMM components.

Antioxidant activity of coffee model systems

Coffee model systems prepared from combinations of chlorogenic acid (CGA), N-alpha-acetyl-1-arginine (A), sucrose (S), and cellulose (C) were roasted at 240 degreesC for 4 min prior to analysis by UV-visible spectrophotometry, capillary zone electrophoresis (CZE), and the ABTS radical cation decolorization assay. The A/CGA/S/C and A/S/C systems were also fractionated by gel filtration chromatography. Antioxidant activity of the systems showed a positive, nonlinear relationship with the amount of CGA remaining after roasting. Sucrose degradation was a major source of color in the heated systems. There was no relationship between antioxidant activity and color generation.

SERS enhancement by aggregated Au colloids: effect of particle size

Aggregated Au colloids have been widely used as SERS enhancing media for many years but to date there has been no systematic investigation of the effect of the particle size on the enhancements given by simple aggregated Au colloid solutions. Previous systematic studies on isolated particles in solution or multiple particles deposited onto surfaces reported widely different optimum particle sizes for the same excitation wavelength and also disagreed on the extent to which surface plasmon absorption spectra were a good predictor of enhancement factors. In this work the spectroscopic properties of a range of samples of monodisperse Au colloids with diameters ranging from 21 to 146 nm have been investigated in solution. The UV/visible absorption spectra of the colloids show complex changes as a function of aggregating salt (MgSO4) concentration which diminish when the colloid is fully aggregated. Under these conditions, the relative SERS enhancements provided by the variously sized colloids vary very significantly across the size range. The largest signals in the raw data are observed for 46 nm colloids but correction for the total surface area available to generate enhancement shows that particles with 74 nm diameter give the largest enhancement per unit surface area. The observed enhancements do not correlate with absorbance at the excitation wavelength but the large differences between differently sized colloids demonstrate that even in the randomly aggregated particle assemblies studied here, inhomogeneous broadening does not mask the underlying changes due to differences in particle diameter.

Nano-structural investigation of Ag/Al2O3 catalyst for selective removal of O-2 with excess H-2 in the presence of C2H4

Ag/gamma-Al2O3 catalysts have been characterized in-depth during different thermo-chemical treatments by in situ diffuse reflectance UV-visible spectroscopy and quasi in situ Transmission Electron Microscopy. The combination of these techniques indicates that sintering and redispersion of silver is clearly observed from the increases and decreases in the absorption band intensity over the range of 250-600 nm due to the presence of silver clusters and silver nanoparticles. These results allow us to study the effect of the reaction feed on the metal dispersion at different operation conditions and discuss the formation of active sites during the selective catalytic reduction of O-2 with excess H-2 in the presence of unsaturated hydrocarbons. In this case high catalytic activity and selectivity toward the oxygen removal was achieved for this catalyst. (C) 2010 Elsevier B.V. All rights reserved.

Fabrication of cerium oxide nanoparticles: Characterization and optical properties

Ceria (CeO2) is a technologically important rare earth material because of its unique properties and various engineering and biological applications. A facile and rapid method has been developed to prepare ceria nanoparticles using microwave with the average size 7 nm in the presence of a set of ionic liquids based on the bis (trifluoromethylsulfonyl) imide anion and different cations of 1-alkyl-3-methyl-imidazolium. The structural features and optical properties of the nanoparticles were determined in depth with X-ray powder diffraction, transmission electron microscope, N-2 adsorption-desorption technique, dynamic light scattering (DLS) analysis, FTIR spectroscopy, Raman spectroscopy, UV-vis absorption spectroscopy, and Diffuse reflectance spectroscopy. The energy band gap measurements of nanoparticles of ceria have been carried out by UV-visible absorption spectroscopy and diffuse reflectance spectroscopy. The surface charge properties of colloidal ceria dispersions in ethylene glycol have been also studied. To the best of our knowledge, this is the first report on using this type of ionic liquids in ceria nanoparticle synthesis. (C) 2011 Elsevier Inc. All rights reserved.

NMR analysis of Nile Blue (C I Basic Blue 12) and Thionine (C I 52000) in solution

The dyes Nile Blue (C I Basic Blue 12) and Thionine (C I 52000) were examined in both ionic and neutral forms in different solvents using NMR and UV-visible spectroscopy to firmly establish the structures of the molecules and to assess the nature and extent of their aggregation H-1 and C-13 NMR assignments and chemical shift data were used together with nuclear Overhauser effect information to propose a self-assembly structure These data were supplemented with variable temperature dilution and diffusion-based experimental results using H-1 NMR spectroscopy thereby enabling extended aggregate structures to be assessed in terms of the relative strength of self-association and the extent to which extended aggregates could form (C) 2010 Elsevier Ltd All rights reserved

Effect of alkali on methylene blue (CI Basic Blue 9) and other thiazine dyes

A detailed study of the action of alkali on methylene blue (Cl. Basic Blue 9) and other thiazine dyes was carried out through a combination of UV/visible spectroscopy, thin layer chromatography, mass and NMR spectrometry and computational methods. In 0.1 M aq alkali solution, methylene blue forms a highly coloured, lipophilic species that is mainly Bernthsen's methylene violet i.e. a hydrolysis decomposition product, this being contrary to the report of a red N-hydroxy methylene blue adduct. The nature of the heterocyclic nitrogen atom in C.I. Basic Blue 9 is discussed and it is concluded there is no basis for the proposal of nucleophile addition at this site of the dye. In contrast, other thiazine dyes are deprotonated by alkali to form their neutral, highly coloured, lipophilic conjugate base forms. (C) 2010 Elsevier Ltd. All rights reserved.

A comprehensive aerosol spray method for the rapid photocatalytic grid area analysis of semiconductor photocatalyst thin films

Indicator inks, previously shown to be capable of rapidly assessing photocatalytic activity via a novel photo-reductive mechanism, were simply applied via an aerosol spray onto commercially available pieces of Activ (TM) self-cleaning glass. Ink layers could be applied with high evenness of spread, with as little deviation as 5% upon UV-visible spectroscopic assessment of 25 equally distributed positions over a 10 cm x 10 cm glass cut. The inks were comprised of either a resazurin (Rz) or dichloroindophenol (DCIP) redox dye with a glycerol sacrificial electron donor in an aqueous hydroxyethyl cellulose (HEC) polymer media. The photo-reduction reaction under UVA light of a single spot was monitored by UV-vis spectroscopy and digital images attained from a flat-bed scanner in tandem for both inks. The photo-reduction of Rz ink underwent a two-step kinetic process, whereby the blue redox dye was initially reduced to a pink intermediate resorufin (Rf) and subsequently reduced to a bleached form of the dye. In contrast, a simple one-step kinetic process was observed for the reduction of the light blue redox dye DCIP to its bleached intermediates. Changes in red-green-blue colour extracted from digital images of the inks were inversely proportional to the changes seen at corresponding wavelengths via UV-visible absorption spectroscopy and wholly indicative of the reaction kinetics. The photocatalytic activity areas of cuts of Activ (TM) glass, 10 cm x 10 cm in size, were assessed using both Rz and DCIP indicator inks evenly sprayed over the films: firstly using UVA lamp light to activate the underlying Activ (TM) film (1.75 mW cm(-2)) and secondly under solar conditions (2.06 +/- 0.14 mW cm(-2)). The photo-reduction reactions were monitored solely by flat-bed digital scanning. Red-green-blue values of a generated 14 x 14 grid (196 positions) that covered the entire area of each film image were extracted using a Custom-built program entitled RGB Extractor(C). A homogenous degradation over the 196 positions analysed for both Rz (Red colour deviation = 19% UVA, 8% Solar: Green colour deviation = 17% UVA, 12% Solar) and DCIP (Red colour deviation = 22% UVA, 16% Solar) inks was seen in both UVA and solar experiments, demonstrating the consistency of the self-cleaning titania layer on Activ (TM). The method presented provides a good solution for the high-throughput photocatalytic screening of a number of homogenous photocatalytically active materials simultaneously or numerous positions on a single film; both useful in assessing the homogeneity of a film or determining the best combination of reaction components to produce the optimum performance photocatalytic film. (C) 2010 Elsevier B.V. All rights reserved.

Simple method for the rapid simultaneous screening of photocatalytic activity over multiple positions of self-cleaning films

An intelligent ink, previously shown to be capable of rapidly assessing photocatalytic activity, was simply applied via a felt-pen onto a commercially available piece of Activ (TM) self-cleaning glass. The ink, comprising of redox dye resazurin and the sacrificial electron donor glycerol within an aqueous hydroxy ethyl cellulose (HEC) polymer media, was photocatalytically degraded in a two-step process. The key initial stage was the photo-reductive conversion of resazurin to resorufin, whereby a colour change from blue to pink occurred. The latter stage was the subsequent photo-reduction of the resorufin, where a slower change from pink to colourless was seen. Red and green components of red-green-blue colour extracted from flat-bed scanner digital images of resazurin ink coated photocatalytic films at intervals during the photocatalysis reaction were inversely proportional to the changes seen via UV-visible absorption spectroscopy and indicative of reaction kinetics. A 3 x 3 grid of intelligent ink was drawn onto a piece of Activ (TM) and a glass blank. The photocatalysis reaction was monitored solely by flat-bed digital scanning. Red-green-blue values of respective positions on the grid were extracted using a custom-built program entitled RGB Extractor (c). The program was capable of extracting a number of 5 x 5 pixel averages of red-green-blue components simultaneously. Allocation of merely three coordinates allowed for the automatic generation of a grid, with scroll-bars controlling the number of positions to be extracted on the grid formed. No significant change in red and green components for any position on the glass blank was observed; however, the Activ (TM) film displayed a homogenous photo-reduction of the dye, reaching maxima in red and minima in green components in 23 +/- 3 and 14 +/- 2 min, respectively. A compositionally graded N-doped titania film synthesised in house via a combinatorial APCVD reaction was also photocatalytically tested by this method where 247 positions on a 13 x 19 grid were simultaneously analysed. The dramatic variation in photocatalysis observed was rapidly quantified for all positions (2-3 hours) allowing for correlations to be made between thicknesses and N : Ti% compositions attained from Swanepoel and WDX analysis, respectively. N incorporation within this system was found to be detrimental to film activity for the photocatalysis reaction of intelligent ink under 365 nm light.

Alkaline hydrolysis of trinitrotoluene, TNT

The kinetics of the alkaline hydrolysis of trinitrotoluene, TNT, in an aqueous solution is a possible approach to destroying the active agent in unwanted munitions. The kinetics are shown to have a rapid initial step, step A, in which a highly coloured species, X (lambda(max) = 450 nm) is formed via an equilibrium reaction: TNT + OH- double left right arrow X. The bimolecular rate constant for the forward part of this equilibrium process, k(1), is: 0.099 +/- 0.004, 0.32 +/- 0.02 and 1.27 +/- 0.05 dm(3) mol(-1) s(-1), at 25, 40 and 60degreesC, respectively. The activation energy for the forward process is 60 kJ mol(-1). The first-order rate constant for the reverse of this process, k(-1), is: (5.3 +/- 2.6) x 10(-4), (1.2 +/- 1.0) x 10(-3) and (7.7 +/- 2.9) x 10(-3) s(-1) at 25, 40 and 60degreesC, respectively. The activation energy for the overall equilibrium process (k(1)/k(-1)) is ca. -5 kJ mol(-1). The subsequent alkaline hydrolysis of X to form the final product P, i.e. step B, is much slower than step A and appears to comprise two processes coupled in series, i.e. steps B1 (X +2OH(-) --> Z) and B2 (Z+OH- --> P). At 25degreesC, Step B1 appears rate determining throughout the decay process. At 45 degreesC and, more so, at 60degreesC, step B appears increasingly biphasic with increasing alkaline concentrations, as step B2 begins to compete with step B1 for position as the rate determining step. The trimolecular rate constant for step B1 is: 0.017 +/- 0.001, 0.0085 +/- 0.0002 and 0.0011 +/- 0.0001 dm(6) mol(-2) s(-1) at 25, 40 and 60degreesC, respectively, and the process has an activation energy of 64 kJ mol(-1). The transition from uniform kinetics, described by step B1, to mixed kinetics, described by steps B1 and B2, as the reaction temperature and alkali concentration are increased most likely occurs because (a) step B2 has a lower activation energy than B1, although it was not possible to measure the former parameter, and (b) step B2 has a lower (1st) order dependence upon [OH-] compared with that of step B1 (2nd). The bimolecular rate constant for step B2 is 0.0035 +/- 0.03 dm(3) mol(-1) s(-1) at 60degreesC. A brief NMR study of the initial hydrolysis product in water, acetone and chloroform, coupled with UV/visible spectra, provides evidence that species X is a Meisenheimer complex.