10 resultados para Thymus
em QUB Research Portal - Research Directory and Institutional Repository for Queen's University Belfast
Resumo:
The checkpoint in cell development that controls successful T cell receptor (TCR) gene rearrangements remains poorly characterized. Using mice expressing a reporter gene 'knocked into' the Tcrd constant region gene, we have characterized many of the events that mark the life of early cells in the adult thymus. We identify the developmental stage during which the Tcrd locus 'opens' in early T cell progenitors and show that a single checkpoint controls cell development during the penultimate CD4-CD8- stage. Passage through this checkpoint required the assembly of TCR heterodimers on the cell surface and signaling via the Lat adaptor protein. In addition, we show that selection triggered a phase of sustained proliferation similar to that induced by the pre-TCR.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Cybr (also known as Cytip, CASP, and PSCDBP) is an interleukin-12-induced gene expressed exclusively in hematopoietic cells and tissues that associates with Arf guanine nucleotide exchange factors known as cytohesins. Cybr levels are dynamically regulated during T-cell development in the thymus and upon activation of peripheral T cells. In addition, Cybr is induced in activated dendritic cells and has been reported to regulate dendritic cell (DC)-T-cell adhesion. Here we report the generation and characterization of Cybr-deficient mice. Despite the selective expression in hematopoietic cells, there was no intrinsic defect in T- or B-cell development or function in Cybr-deficient mice. The adoptive transfer of Cybr-deficient DCs showed that they migrated efficiently and stimulated proliferation and cytokine production by T cells in vivo. However, competitive stem cell repopulation experiments showed a defect in the abilities of Cybr-deficient T cells to develop in the presence of wild-type precursors. These data suggest that Cybr is not absolutely required for hematopoietic cell development or function, but stem cells lacking Cybr are at a developmental disadvantage compared to wild-type cells. Collectively, these data demonstrate that despite its selective expression in hematopoietic cells, the role of Cybr is limited or largely redundant. Previous in vitro studies using overexpression or short interfering RNA inhibition of the levels of Cybr protein appear to have overestimated its immunological role.
Resumo:
Viral and non-viral vectors have been developed for gene therapy, but their use is associated with unresolved problems of efficacy and safety. Efficient and safe methods of DNA delivery need to be found for medical application. Here we report a new monopolar system of non-viral electro-gene transfer into the thymus in vivo that consists of the local application of electrical pulses after the introduction of the DNA. We assessed the proof of concept of this approach by correcting ZAP-70 deficient severe combined immunodeficiency (SCID) in mice. The thymic electro-gene transfer of the pCMV-ZAP-70-IRES-EGFP vector in these mice resulted in rapid T cell differentiation in the thymus with mature lymphocytes detected by three weeks in secondary lymphoid organs. Moreover, this system resulted in the generation of long-term functional T lymphocytes. Peripheral reconstituted T cells displayed a diversified T cell receptor (TCR) repertoire, and were responsive to alloantigens in vivo. This process applied to the thymus could represent a simplified and effective alternative for gene therapy of T cell immunodeficiencies.
Resumo:
The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.
Resumo:
A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.
Resumo:
We have previously shown that mice lacking the IL-12-specific receptor subunit ß2 (IL-12Rß2) develop more severe experimental autoimmune encephalomyelitis than wild-type (WT) mice. The mechanism underlying this phenomenon is not known; nor is it known whether deficiency of IL-12Rß2 impacts other autoimmune disorders similarly. In the present study we demonstrate that IL-12Rß2-/- mice develop earlier onset and more severe disease in the streptozotocin-induced model of diabetes, indicating predisposition of IL-12Rß2-deficient mice to autoimmune diseases. T cells from IL-12Rß2-/- mice exhibited significantly higher proliferative responses upon TCR stimulation. The numbers of naturally occurring CD25+CD4+ regulatory T cells (Tregs) in the thymus and spleen of IL-12Rß2-/- mice were comparable to those of WT mice. However, IL-12Rß2-/- mice exhibited a significantly reduced capacity to develop Tregs upon stimulation with TGF-ß, as shown by significantly lower numbers of CD25+CD4+ T cells that expressed Foxp3. Functionally, CD25+CD4+ Tregs derived from IL-12Rß2-/- mice were less efficient than those from WT mice in suppressing effector T cells. The role of IL-12Rß2 in the induction of Tregs was confirmed using small interfering RNA. These findings suggest that signaling via IL-12Rß2 regulates both the number and functional maturity of Treg cells, which indicates a novel mechanism underlying the regulation of autoimmune diseases by the IL-12 pathway. Copyright © 2008 by The American Association of Immunologists, Inc.
Resumo:
Genetic or vitamin D3-induced overexpression of thymic stromal lymphopoietin (TSLP) by keratinocytes results in an atopic dermatitis (AD)-like inflammatory phenotype in mice echoing the discovery of high TSLP expression in epidermis from AD patients. Although skin dendritic cells (DC) are suspected to be involved in AD, direct evidence of a pathogenetic role for skin DC in TSLP-induced skin inflammation has not yet been demonstrated. In a mouse model of AD, i.e. mice treated with the low-calcemic vitamin D3 analogue, MC903, we show that epidermal Langerhans cells (LC)-depleted mice treated with MC903 do neither develop AD-like inflammation nor increased serum IgE as compared to vitamin D3 analogue-treated control mice. Accordingly, we show that, in mice treated with MC903 or in K14-TSLP transgenic mice, expression of maturation markers by LC is increased whereas maturation of dermal DC is not altered. Moreover, only LC are responsible for the polarization of naive CD4+ T cells to a Th2 phenotype, i.e. decrease in interferon-gamma and increase in interleukin (IL)-13 production by CD4+ T cells. This effect of LC on T-lymphocytes does not require OX40-L/CD134 and is mediated by a concomitant down-regulation of IL-12 and CD70. Although it was previously stated that TSLP up-regulates the production of thymus and activation-regulated chemokine (TARC)/chemokine (C-C motif) ligand 17 (CCL17) and macrophage-derived chemokine (MDC)/CCL22 by human LC in vitro, our work shows that production of these Th2- cell attracting chemokines is increased only in keratinocytes in response to TSLP overexpression. These results demonstrate that LC are required for the development of AD in mouse models of AD involving epidermal TSLP overexpression.
Resumo:
Resonance Raman (RR) spectroscopy has been used to probe the interaction between dipyridophenazine (dppz) complexes of ruthenium(II), [Ru(L)(2)(dppz)](2+) (L = 1,10-phenanthroline (1) and 2,2-bipyridyl (2)), and calf-thymus DNA. Ground electronic state RR spectra at selected probe wavelengths reveal enhancement patterns which reflect perturbation of the dppz-centered electronic transitions in the UV-vis spectra in the presence of DNA. Comparison of the RR spectra recorded of the short-lived MLCT excited states of both complexes in aqueous solution with those of the longer-lived states of the complexes in the DNA environment reveals changes to excited state modes, suggesting perturbation of electronic transitions of the dppz ligand in the excited state as a result of intercalation. The most prominent feature, at 1526 cm(-1), appears in the spectra of both 1 and 2 and is a convenient marker band for intercalation. For 1, the excited state studies have been extended to the A and A enantiomers. The marker band appears at the same frequency for both but with different relative intensities. This is interpreted as reflecting the distinctive response of the enantiomers to the chiral environment of the DNA binding sites. The results, together with some analogous data for other potentially intercalating complexes, are considered in relation to the more general application of time-resolved RR spectroscopy for investigation of intercalative interactions of photoexcited metal complexes with DNA.
Resumo:
The resonance-Raman spectroscopic technique is an effective probe of the interaction between dipyridophenazine (dppz) complexes of ruthenium(II) and calf-thymus DNA, providing evidence that DNA addition results in changes to electronic transitions of the intercalating dppz ligand in both ground and excited states.