170 resultados para TOOTH BLEACHING AGENTS
em QUB Research Portal - Research Directory and Institutional Repository for Queen's University Belfast
Resumo:
The relative sensitivity of neoplastic cells to DNA damaging agents is a key factor in cancer therapy. In this paper, we show that pretreatment of Burkitt's lymphoma cell lines expressing the c-met protooncogene with hepatocyte growth factor (HGF) protects them from death induced by DNA damaging agents commonly used in tumour therapy. This protection was observed in assays based on morphological assessment of apoptotic cells and DNA fragmentation assays. The protection was dose- and time-dependent — maximal protection requiring pre-incubation with 100 ng/ml HGF for 48 h. Western blotting analysis and flow cytometric studies revealed that HGF inhibited doxorubicin- and etoposide-induced decreases in the levels of the anti-apoptotic proteins Bcl-XL, and to a lesser extent Bcl-2, without inducing changes in the pro-apoptotic Bax protein. Overall, these studies suggest that the accumulation of HGF within the microenvironment of neoplastic cells may contribute to the development of a chemoresistant phenotype.
Resumo:
BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.