Advanced glycation end products induce blood-retinal barrier dysfunction in normoglycemic rats

Advanced glycation end products (AGEs) have been implicated in the progressive vascular dysfunction which occurs during diabetic retinopathy. In the current study we have examined the role of these adducts in blood-retinal barrier (BRB) breakdown and investigated expression of the vasopermeabilizing agent vascular endothelial growth factor (VEGF) in the retina. When normoglycemic rats were injected with AGE-modified albumin daily for up to 10 days there was widespread leakage of FITC-dextran and serum albumin from the retinal vasculature when compared to control animals treated with nonmodified albumin. Ultrastructural examination of the vasculature revealed areas of attenuation of the retinal vascular endothelium and increased vesicular organelles only in the AGE-exposed rats. Quantitative RT-PCR and in situ hybridization demonstrated a significant increase in retinal VEGF mRNA expression (P <0.05). These results suggest that AGEs can initiate BRB dysfunction in nondiabetic rats and a concomitant increase in retinal VEGF expression. These findings may have implications for the role of AGEs in the pathogenesis of diabetic retinopathy.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

The Septin-Binding Protein Anillin is Over-Expressed in Diverse Human Tumours

Anillin is an actin-binding protein that can bind septins and is a component of the cytokinetic ring. We assessed the anillin expression in 7,579 human tissue samples and cell lines by DNA micro-array analysis. Anillin is expressed ubiquitously but with variable levels of expression, being highest in the central nervous system. The median level of anillin mRNA expression was higher in tumors than normal tissues (median fold increase 2.58; 95% confidence intervals, 2.19-5.68, P < 0.0001) except in the central nervous system where anillin in RNA levels were lower in tumors. We developed a sensitive reverse transcription-PCR strategy to show that anillin mRNA is expressed in cell lines and in cDNA panels derived from fetal and adult tissues, thus validating the microarray data. We compared anillin with Ki67 in RNA expression and found a significant linear relationship between anillin and Ki67 mRNA expression (Spearmann r similar to 0.6, P < 0.0001). Anillin mRNA expression was analyzed during tumor progression in breast, ovarian, kidney, colorectal, hepatic, lung, endometrial, and pancreatic tumors and in all tissues there was progressive, increase in anillin mRNA expression from normal to benign to malignant to metastatic disease. Finally, we used anti-anillin sera and found nuclear anillin immuncireactivity to be widespread in normal tissues, often not correlating with proliferative compartments. These data provide insight into the existence of non proliferation-associated activities of anillin and roles in interphase nuclei. Thus, anillin is overexpressed in diverse common human tumors, but not simply as a consequence of being a proliferation marker. Anillin may have potential as a novel biomarker.

IntCal04 terrestrial radiocarbon age calibration, 0-26 cal kyr BP

A new calibration curve for the conversion of radiocarbon ages to calibrated (cal) ages has been constructed and internationally ratified to replace IntCal98, which extended from 0-24 cal kyr BP (Before Present, 0 cal BP = AD 1950). The new calibration data set for terrestrial samples extends from 0-26 cal kyr BP, but with much higher resolution beyond 11.4 cal kyr BP than IntCal98. Dendrochronologically-dated tree-ring samples cover the period from 0-12.4 cal kyr BP. Beyond the end of the tree rings, data from marine records (corals and foraminifera) are converted to the atmospheric equivalent with a site-specific marine reservoir correction to provide terrestrial calibration from 12.4-26.0 cal kyr BP. A substantial enhancement relative to IntCal98 is the introduction of a coherent statistical approach based on a random walk model, which takes into account the uncertainty in both the calendar age and the (super 14) C age to calculate the underlying calibration curve (Buck and Blackwell, this issue). The tree-ring data sets, sources of uncertainty, and regional offsets are discussed here. The marine data sets and calibration curve for marine samples from the surface mixed layer (Marine04) are discussed in brief, but details are presented in Hughen et al. (this issue a). We do not make a recommendation for calibration beyond 26 cal kyr BP at this time; however, potential calibration data sets are compared in another paper (van der Plicht et al., this issue).