Algorithmic computation of knot polynomials of secondary structure elements of proteins

The classification of protein structures is an important and still outstanding problem. The purpose of this paper is threefold. First, we utilize a relation between the Tutte and homfly polynomial to show that the Alexander-Conway polynomial can be algorithmically computed for a given planar graph. Second, as special cases of planar graphs, we use polymer graphs of protein structures. More precisely, we use three building blocks of the three-dimensional protein structure-alpha-helix, antiparallel beta-sheet, and parallel beta-sheet-and calculate, for their corresponding polymer graphs, the Tutte polynomials analytically by providing recurrence equations for all three secondary structure elements. Third, we present numerical results comparing the results from our analytical calculations with the numerical results of our algorithm-not only to test consistency, but also to demonstrate that all assigned polynomials are unique labels of the secondary structure elements. This paves the way for an automatic classification of protein structures.

Structure-activity studies on position 14 of human alpha-calcitonin gene-related peptide

A structure-activity study was performed to examine the role of position 14 of human alpha-calcitonin gene-related peptide (h-alpha-CGRP) in activating the CGRP receptor. Interestingly, position 14 of h-alpha-CGRP contains a glycyl residue and is part of an alpha-helix spanning residues 8-18. Analogues [Ala(14)]-h-alpha-CGRP, [Aib(14)]-h-alpha-CGRP, [Asp(14)]-h-alpha-CGRP, [Asn(14)]-h-alpha-CGRP, and [Pro(14)]-h-alpha-CGRP were synthesized by solid phase peptide methodology and purified by RP-HPLC. Secondary structure was measured by circular dichroism spectroscopy. Agonist activities were determined as the analogues' ability to stimulate amylase secretion from guinea pig pancreatic acini and to relax precontracted porcine coronary arteries. Analogues [Ala(1)4]-h-alpha-CGRP, [Aib(14)]-h-alpha-CGRP, [Asp(14)]-h-alpha-CGRP, and [Asn(14)]-h-alpha-CGRP, all containing residues with a high helical propensity in position 14, were potent full agonists compared to h-alpha-CGRP in both tissues. Interestingly, replacement of Gly(14) of h-alpha-CGRP with these residues did not substantially increase the helical content of these analogues. [Pro(14)]-h-alpha-CGRP, predictably, has significantly lower helical content and is a 20-fold less potent agonist on coronary artery, known to contain CGRP-1 receptor subtypes, and an antagonist on pancreatic acini, known to contain CGRP-2 receptor subtypes. In conclusion, the residue in position 14 plays a structural role in stabilizing the alpha-helix spanning residues 8-18. The alpha-helix is crucial for maintaining highly potent agonist effects of h-alpha-CGRP at CGRP receptors. The wide variety of functional groups that can be tolerated in position 14 with no substantial modification of agonist effects suggests the residue in this position is not in contact with the CGRP receptor. [Pro(14)]-h-alpha-CGRP may be a useful pharmacological tool to distinguish between CGRP-1 and CGRP-2 receptor subtypes.

Influence of alpha-helicity, amphipathicity and D-amino acid incorporation on the peptide-induced mast cell activation

Mast cell activation by polycationic substances is believed to result from a direct activation of G protein alpha subunits and it was suggested that the adaption of amphipathic, alpha-helical conformations would allow the peptide to reach the cytosolic compartment to interact with G proteins (Mousli et al., 1994, Immunopharmacology 27, 1, for review). We investigated the histamine-releasing activity of model peptides as well as analogues of magainin 2 amide and neuropeptide Y with different amphipathicities and alpha-helix content on rat peritoneal mast cells. Amphipathic helicity is not a prerequisite for mast cell activation. Moreover, non-helical magainin peptides with high histamine-releasing activity were less active in the liberation of carboxyfluoresceine from negatively charged liposomes, indicating that peptide-induced mast cell activation and peptide-induced membrane perturbation do not correlate. In contrast to the negligible influence of the secondary structure, amino acid configuration may exert a striking influence on peptide-induced mast cell activation. Thus histamine-release by substance P was markedly impaired when the L-amino acids in the positively charged N-terminal region were replaced by D-amino acids, with [D-Arg(1)]substance P being the most inactive substance P diastereoisomer.

Identification and functional analysis of a novel bradykinin inhibitory peptide in the venoms of New World Crotalinae pit vipers.

A novel undecapeptide has been isolated and structurally characterized from the venoms of three species of New World pit vipers from the subfamily, Crotalinae. These include the Mexican moccasin (Agkistrodon bilineatus), the prairie rattlesnake (Crotalus viridis viridis), and the South American bushmaster (Lachesis muta). The peptide was purified from all three venoms using a combination of gel permeation chromatography and reverse-phase HPLC. Automated Edman degradation sequencing and MALDI-TOF mass spectrometry established its peptide primary structure as: Thr-Pro-Pro-Ala-Gly-Pro-Asp-Val-Gly-Pro-Arg-OH, with a non-protonated molecular mass of 1063.18 Da. A synthetic replicate of the peptide was found to be an antagonist of bradykinin action at the rat vascular B2 receptor. This is the first bradykinin inhibitory peptide isolated from snake venom. Database searching revealed the peptide to be highly structurally related (10/11 residues) with a domain residing between the bradykinin-potentiating peptide and C-type natriuretic peptide domains of a recently cloned precursor from tropical rattlesnake (Crotalus durissus terrificus) venom gland. BIP thus represents a novel biological entity from snake venom.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

DPP IV resistance and insulin releasing activity of a novel di-substituted analogue of glucose-dependent insulinotropic polypeptide, (Ser(2)-Asp(13))GIP

Structure-function studies suggest that preservation of the N-terminus and secondary structure of glucose-dependent insulinotropic polypeptide (GIP) is important for biological activity. Therefore, a novel di-substituted analogue of GIP, (Ser(2)-Asp(13))GIP, containing a negatively charged Asp residue in place of an Ala in position 13, seas synthesised and evaluated for in vitro biological activity. Incubation with dipeptidyl peptidase IV (DPP IV) showed the half-lives of GIP and (Ser(2)-Asp(13))GIP to be 2.3 and >4 h, respectively. Insulin releasing studies in clonal pancreatic BRIN-BD11 cells demonstrated that (Ser(2)-Asp(13))GIP (10(-12) to 10(-7) mol/l) was significantly less potent (60-90%; P

Functional analysis of the C-terminal domain of the WbaP protein that mediates initiation of O antigen synthesis in Salmonella enterica

WbaP catalyzes the transfer of galactose-1-phosphate onto undecaprenyl phosphate (Und-P). The enzyme belongs to a large family of bacterial membrane proteins required for initiation of the synthesis of O antigen lipopolysaccharide and polysaccharide capsules. Previous work in our laboratory demonstrated that the last transmembrane helix and C-terminal tail region of WbaP (WbaP(CT)) are sufficient for enzymatic activity. Here, we demonstrate the cytoplasmic location of the WbaP C-terminal tail and show that WbaPCT domain N-terminally fused to thioredoxin (TrxA-WbaP(CT)) exhibits improved protein folding and enhanced transferase activity. Alanine replacement of highly conserved charged or polar amino acids identified seven critical residues for enzyme activity in vivo and in vitro. Four of these residues are located in regions predicted to be a-helical. These regions and their secondary structure predictions are conserved in distinct WbaP family members, suggesting they may contribute to form a conserved catalytic center.

FLT1 Genetic Variation Predisposes to Neovascular AMD in Ethnically Diverse Populations and Alters Systemic FLT1 Expression

Purpose: Current understanding of the genetic risk factors for age-related macular degeneration (AMD) is not sufficiently predictive of the clinical course. The VEGF pathway is a key therapeutic target for treatment of neovascular AMD; however, risk attributable to genetic variation within pathway genes is unclear. We sought to identify single nucleotide polymorphisms (SNPs) associated with AMD within the VEGF pathway.
Methods: Using a tagSNP, direct sequencing and meta-analysis approach within four ethnically diverse cohorts, we identified genetic risk present in FLT1, though not within other VEGF pathway genes KDR, VEGFA, or VASH1. We used ChIP and ELISA in functional analysis.
Results: The FLT1 SNPs rs9943922, rs9508034, rs2281827, rs7324510, and rs9513115 were significantly associated with increased risk of neovascular AMD. Each association was more significant after meta-analysis than in any one of the four cohorts. All associations were novel, within noncoding regions of FLT1 that do not tag for coding variants in linkage disequilibrium. Analysis of soluble FLT1 demonstrated higher expression in unaffected individuals homozygous for the FLT1 risk alleles rs9943922 (P = 0.0086) and rs7324510 (P = 0.0057). In silico analysis suggests that these variants change predicted splice sites and RNA secondary structure, and have been identified in other neovascular pathologies. These data were supported further by murine chromatin immunoprecipitation demonstrating that FLT1 is a target of Nr2e3, a nuclear receptor gene implicated in regulating an AMD pathway.
Conclusions: Although exact variant functions are not known, these data demonstrate relevancy across ethnically diverse genetic backgrounds within our study and, therefore, hold potential for global efficacy.

Probing the Unfolded Configurations of a β-Hairpin Using Sketch-Map

This work examines the conformational ensemble involved in β-hairpin folding by means of advanced molecular dynamics simulations and dimensionality reduction. A fully atomistic description of the protein and the surrounding solvent molecules is used, and this complex energy landscape is sampled by means of parallel tempering metadynamics simulations. The ensemble of configurations explored is analyzed using the recently proposed sketch-map algorithm. Further simulations allow us to probe how mutations affect the structures adopted by this protein. We find that many of the configurations adopted by a mutant are the same as those adopted by the wild-type protein. Furthermore, certain mutations destabilize secondary-structure-containing configurations by preventing the formation of hydrogen bonds or by promoting the formation of new intramolecular contacts. Our analysis demonstrates that machine-learning techniques can be used to study the energy landscapes of complex molecules and that the visualizations that are generated in this way provide a natural basis for examining how the stabilities of particular configurations of the molecule are affected by factors such as temperature or structural mutations.

Hybrid Diphenylalkyne-Dipeptide Oligomers Induce Multistrand β-Sheet Formation

Functionalized diphenylalkynes provide a template for the presentation of protein-like surfaces composed of multistrand β-sheets. The conformational properties of three-, four-, and seven-stranded systems have been investigated in the solid- and solution-state. This class of molecule may be suitable for the mediation of therapeutically relevant protein-protein interactions.

Structure-based design of HSPA5 inhibitors: From peptide to small molecule inhibitors

We identified nine small-molecule hit compounds of Heat shock 70 kDa protein 5 (HSPA5) from cascade in silico screening based on the binding modes of the tetrapeptides derived from the peptide substrate or inhibitors of Escherichia coli HSP70. Two compounds exhibit promising inhibition activities from cancer cell viability and tumor inhibition assays. The binding modes of the hit compounds provide a platform for development of selective small molecule inhibitors of HSPA5. (C) 2013 Elsevier Ltd. All rights reserved.

Peptide leucine arginine, a potent immunomodulatory peptide isolated and structurally characterized from the skin of the Northern Leopard frog, Rana pipiens

On the basis of histamine release from rat peritoneal mast cells, an octadecapeptide was isolated from the skin extract of the Northern Leopard frog (Rana pipiens), This peptide was purified to homogeneity using reversed-phase high performance liquid chromatography and found to have the following primary structure by Edman degradation and pyridylethylation: LVRGCWTKSYPPKPCFVR, in which Cys(5) and Cys(15) are disulfide bridged. The peptide was named peptide leucine-arginine (pLR), reflecting the N- and C-terminal residues. Molecular modeling predicted that pLR possessed a rigid tertiary loop structure with flexible end regions, pLR was synthesized and elicited rapid, noncytolytic histamine release that had a a-fold greater potency when compared with one of the most active histamine-liberating peptides, namely melittin, pLR was able to permeabilize negatively charged unilamellar lipid vesicles but not neutral vesicles, a finding that was consistent with its nonhemolytic action, pLR inhibited the early development of granulocyte macrophage colonies from bone marrow stem cells but did not induce apoptosis of the end stage granulocytes, i,e. mature neutrophils, pLR therefore displays biological activity with both granulopoietic progenitor cells and mast cells and thus represents a novel bioactive peptide from frog skin.

The Industrial Context of Occupational Mobility: Change in Structure

The neglect of a consideration of history has been a feature of mobility research. ‘History’ affects the results of analyses of social mobility by altering the occupational/industrial structure and by encouraging exchange mobility. Changes in industrial structure are rooted more directly in historical causes and can be seen as more fundamental than changes in occupational structure. Following a substantial review of the secondary literature on changes in industrial and occupational structure in Northern Ireland, loglinear analyses of intra- and intergenerational mobility tables for sociologically-derived cohort generations that incorporate occupational and industrial categories are presented. Structural and inheritance effects for industry are as significant as those for occupation. Given the well-established finding of ‘constant social fludity’ in mobility tables once structural effects are controlled, the inclusion of categorization by industry is necessary in order to reach an accurate understanding of occupational mobility and the role of historical change in mobility.

Partial structure of the phylloxin gene from the giant monkey frog, Phyllomedusa bicolor: parallel cloning of precursor cDNA and genomic DNA from lyophilized skin secretion

Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.