Abeta oligomer toxicity inhibitor protects memory in models of synaptic toxicity

BACKGROUND AND PURPOSE:

Amyloid-ß (Aß) aggregation into synaptotoxic, prefibrillar oligomers is a major pathogenic event underlying the neuropathology of Alzheimer's disease (AD). The pharmacological and neuroprotective properties of a novel Aß aggregation inhibitor, SEN1269, were investigated on aggregation and cell viability and in test systems relevant to synaptic function and memory, using both synthetic Aß(1-42) and cell-derived Aß oligomers.
EXPERIMENTAL APPROACH:

Surface plasmon resonance studies measured binding of SEN1269 to Aß(1-42) . Thioflavin-T fluorescence and MTT assays were used to measure its ability to block Aß(1-42) -induced aggregation and reduction in cell viability. In vitro and in vivo long-term potentiation (LTP) experiments measured the effect of SEN1269 on deficits induced by synthetic Aß(1-42) and cell-derived Aß oligomers. Following i.c.v. administration of the latter, a complex (alternating-lever cyclic ratio) schedule of operant responding measured effects on memory in freely moving rats.
KEY RESULTS:

SEN1269 demonstrated direct binding to monomeric Aß(1-42) , produced a concentration-related blockade of Aß(1-42) aggregation and protected neuronal cell lines exposed to Aß(1-42) . In vitro, SEN1269 alleviated deficits in hippocampal LTP induced by Aß(1-42) and cell-derived Aß oligomers. In vivo, SEN1269 reduced the deficits in LTP and memory induced by i.c.v. administration of cell-derived Aß oligomers.
CONCLUSIONS AND IMPLICATIONS:

SEN1269 protected cells exposed to Aß(1-42) , displayed central activity with respect to reducing Aß-induced neurotoxicity and was neuroprotective in electrophysiological and behavioural models of memory relevant to Aß-induced neurodegeneration. It represents a promising lead for designing inhibitors of Aß-mediated synaptic toxicity as potential neuroprotective agents for treating AD.

Pharmacokinetics of melatonin in preterm infants

Aims: Preterm infants are deprived of the normal intra-uterine exposure to maternal melatonin and may benefit from replacement therapy. We conducted a pharmacokinetic study to guide potential therapeutic trials. Methods: Melatonin was administered to 18 preterm infants in doses ranging from 0.04-0.6μgkg^-1 over 0.5-6h. Pharmacokinetic profiles were analyzed individually and by population methods. Results: Baseline melatonin was largely undetectable. Infants receiving melatonin at 0.1μgkg^-1h^-1 for 2h showed a median half-life of 15.82h and median maximum plasma concentration of 203.3pgml^-1. On population pharmacokinetics, clearance was 0.045lh^-1, volume of distribution 1.098l and elimination half-life 16.91h with gender (P = 0.047) and race (P < 0.0001) as significant covariates. Conclusions: A 2h infusion of 0.1μgkg^-1h^-1 increased blood melatonin from undetectable to approximately peak adult concentrations. Slow clearance makes replacement of a typical maternal circadian rhythm problematic. The pharmacokinetic profile of melatonin in preterm infants differs from that of adults so dosage of melatonin for preterm infants cannot be extrapolated from adult studies. Data from this study can be used to guide therapeutic clinical trials of melatonin in preterm infants. © 2013 The British Pharmacological Society.

Hepatocyte growth factor (HGF) protects c-met-expressing Burkitt''s lymphoma cell lines from apoptotic death induced by DNA damaging agents

The relative sensitivity of neoplastic cells to DNA damaging agents is a key factor in cancer therapy. In this paper, we show that pretreatment of Burkitt's lymphoma cell lines expressing the c-met protooncogene with hepatocyte growth factor (HGF) protects them from death induced by DNA damaging agents commonly used in tumour therapy. This protection was observed in assays based on morphological assessment of apoptotic cells and DNA fragmentation assays. The protection was dose- and time-dependent — maximal protection requiring pre-incubation with 100 ng/ml HGF for 48 h. Western blotting analysis and flow cytometric studies revealed that HGF inhibited doxorubicin- and etoposide-induced decreases in the levels of the anti-apoptotic proteins Bcl-XL, and to a lesser extent Bcl-2, without inducing changes in the pro-apoptotic Bax protein. Overall, these studies suggest that the accumulation of HGF within the microenvironment of neoplastic cells may contribute to the development of a chemoresistant phenotype.

BRCA1 and GADD45 mediated G2/M cell cycle arrest in response to antimicrotubule agents

BRCA1 is a tumour suppressor gene implicated in the predisposition to early onset breast and ovarian cancer. We have generated cell lines with inducible expression of BRCA1 to evaluate its role in mediating the cellular response to various chemotherapeutic drugs commonly used in the treatment of breast and ovarian cancer. Induction of BRCA1 in the presence of Taxol and Vincristine resulted in a dramatic increase in cell death; an effect that was preceded by an acute arrest at the G2/M phase of the cell cycle and which correlated with BRCA1 mediated induction of GADD45. A proportion of the arrested cells were blocked in mitosis suggesting activation of both a G2 and a mitotic spindle checkpoint. In contrast, no specific interaction was observed between BRCA1 induction and treatment of cells with a range of DNA damaging agents including Cisplatin and Adriamycin. Inducible expression of GADD45 in the presence of Taxol induced both G2 and mitotic arrest in these cells consistent with a role for GADD45 in contributing to these effects. Our results support a role for both BRCA1 and GADD45 in selectively regulating a G2/M checkpoint in response to antimicrotubule agents and raise the possibility that their expression levels in cells may contribute to the toxicity observed with these compounds.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.