89 resultados para LAMBDA-HYPERNUCLEI
em QUB Research Portal - Research Directory and Institutional Repository for Queen's University Belfast
Resumo:
The characterization of thermocouple sensors for temperature measurement in varying-flow environments is a challenging problem. Recently, the authors introduced novel difference-equation-based algorithms that allow in situ characterization of temperature measurement probes consisting of two-thermocouple sensors with differing time constants. In particular, a linear least squares (LS) lambda formulation of the characterization problem, which yields unbiased estimates when identified using generalized total LS, was introduced. These algorithms assume that time constants do not change during operation and are, therefore, appropriate for temperature measurement in homogenous constant-velocity liquid or gas flows. This paper develops an alternative ß-formulation of the characterization problem that has the major advantage of allowing exploitation of a priori knowledge of the ratio of the sensor time constants, thereby facilitating the implementation of computationally efficient algorithms that are less sensitive to measurement noise. A number of variants of the ß-formulation are developed, and appropriate unbiased estimators are identified. Monte Carlo simulation results are used to support the analysis.
Resumo:
The enantiomerically pure ligands LRR and LSS (N,N'-bis(-2,2'-bipyridyl-5-yl)carbonyl-(1S/R,2S/R)-(+/-)-1,2-diaminocyclohexane) have been synthesised by linking two 2,2'-bipyridine units by (R,R)- and (S,S)-1,2-diaminocyclohexane respectively. The crystal structure confirmed that the ligand had a twisted orientation between the two chelating units. The reaction of LRR and LSS with Fe(II), Co(III), Cd(II) and Zn(II) afforded dinuclear complexes confirmed by ES mass spectroscopy. CD spectroscopy indicated that the chiral diaminocyclohexane conferred helicity to the metal centre giving a dominant triple helicate diastereoisomer, with the LRR ligand giving a delta-configuration of each metal centre (P helicate) and the LSS ligand a lambda configuration (M helicate). 1H NMR spectroscopy confirmed a dominant major diastereoisomer with cadmium. The Zn(II) and Cd(II) complexes however were observed to undergo rapid ligand dissociation in solution.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
We present high-resolution (R = lambda/Deltalambda similar to 40 000) Ca II K interstellar observations (lambda(air) = 3933.66Angstrom) towards 88 mainly B-type stars, of which 74 are taken from the Edinburgh-Cape or Palomar-Green surveys, and 81 have > 25degrees. The majority of the data come from previously existing spectroscopy, although also included are 18 new observations of stars with echelle spectra taken with UVES on the Very Large Telescope UT2 (Kueyen). Some 49 of the sample stars have distance estimates above the Galactic plane (z) greater than or equal to 1 kpc, and are thus good probes of the halo interstellar medium. Of the 362 interstellar Ca K components that we detect, 75 (21 per cent) have absolute values of their LSR velocity values exceeding 40 km s(-1). In terms of the deviation velocity for the sightlines with distance estimates, 46/273 (17 per cent) of components have velocity values exceeding those predicted by standard Galactic rotation by more than 40 km s(-1). Combining this data set with previous observations, we find that the median value of the reduced equivalent width (REW) of stars with z greater than or equal to 1 kpc (EW x sin ) is similar to 115 mAngstrom (n = 80), similar to that observed in extragalactic sightlines by Bowen. Using data of all z distances, the REW at infinity is found to be similar to 130 mAngstrom, with the scaleheight (1) of the Ca II K column density distribution being;z 800 pc (n = 196) and reduced column density at infinity of log[N(Ca II K) cm(-2)] similar to 12.24. This implies that similar to30 per cent of Ca II K absorption occurs at distances exceeding similar to1 kpc. For nine sightlines, with distance exceeding 1 kpc and with a companion object within 5degrees, we find that all but two have values of Ca II reduced equivalent width the same to within similar to20 per cent, when the REW of the nearest object is extrapolated to the distance of the further of the pair, and assuming 1 = 800 pc. For 29 of our sightlines with z greater than or equal to 1 kpc and a H I detection from the Leiden-Dwingeloo survey (beamsize of 0.5degrees), we find log(N(Ca II K)IN(H I)) ranging from -7.4 to - 8.4. Values of the Ca II K abundance relative to neutral hydrogen (log[N(Ca II K) cm(-2)] - log[N(H I) cm(-2)]) are found to be more than similar to0.5 dex higher in stars with distances exceeding approximate to100 pc, when compared with the (log[N(Ca II K) cm(-2)] -log[N(H-tot) cm(-2)]) values found in nearby sightlines such as those in Wakker & Mathis (2000). Finally, stellar Ca II K equivalent widths of the sample are determined for 26 objects.
Resumo:
We compare existing high spectral resolution (R = lambda/Deltalambda similar to 40 000) Ca II Kobservations (lambda(air) = 3933.66 Angstrom) towards 88 mainly B-type stars, and new observations taken using the Intermediate dispersion Spectrograph and Imaging System (ISIS) on the William Herschel Telescope at R similar to 10 000 towards three stars taken from the Palomar-Green Survey, with 21-cm HI emission-line profiles, in order to search for optical absorption towards known intermediate- and high-velocity cloud complexes. Given certain assumptions, limits to the gas phase abundance of Ca II are estimated for the cloud components. We use the data to derive the following distances from the Galactic plane (z). (i) Tentative lower z-height limits of 2800 and 4100 pc towards complex C using lack of absorption in the spectra of HD341617 and PG 0855 + 294, respectively. (ii) A weak lower z-height of 1400 pc towards complex WA-WB using lack of absorption in EC 09470-1433 and a weak lower limit of 2470 pc using lack of absorption in EC 09452-1403. (iii) An upper z- height of 2470 pc towards a southern intermediate- velocity cloud (IVC) with v(LSR) = -55 km s(-1) using PG 2351 + 198. (iv) Detection of a possible IVC in Ca II absorption at v(LSR) = +52 km s(-1) using EC 20104-2944. No associated HI in emission is detected. At this position, normal Galactic rotation predicts velocities of up to similar to+ 25 km s(-1). The detection puts an upper z-height of 1860 pc to the cloud. (v) Tentative HI and Ca II K detections towards an IVC at similar to+70 km s(-1) in the direction of high-velocity cloud (HVC) complex WE, sightline EC 06387-8045, indicating that the IVC may be at a z-height lower than 1770 pc. (vi) Detection of Ca II K absorption in the spectrum of PG 0855 + 294 in the direction of IV20, indicating that this IVC has a z-height smaller than 4100 pc. (vii) A weak lower z-height of 4300 pc towards a small HVC with v(LSR) = +115 km s(-1) at l, b = 200degrees, + 52degrees, using lack of absorption in the Ca II K spectrum of PG 0955 + 291.
Resumo:
We present echelle spectrograph observations in the Na D lines, at resolutions of 6.2-8.5 km s(-1), for 11 stars located in the line-of-sight to the M15 intermediate velocity cloud (IVC), which has a radial velocity of similar to +70 km s(-1) in the Local Standard of Rest. This cloud is a part of IVC Complex gp. The targets range in magnitude from m(V) = 13.3-14.8. Seven of the observed stars are in the M15 globular cluster, the remaining four being field stars. Three of the observed cluster stars are located near a peak in intensity of the IVC Hi column density as observed at a resolution of similar to 1 arcmin. Intermediate velocity gas is detected in absorption towards 7 stars, with equivalent widths in NaD2 ranging from similar to0.09-0.20 Angstrom, corresponding to log(10)(N-Na cm(-2)) similar to 11.8-12.5, and Na I/H I column density ratios (neglecting the HII component) ranging from similar to(1-3) x 10(-8). Over scales ranging from 30 arcsec to 1 arcmin, the Na i column density and the Na i/H i ratio varies by upto 70 per cent and a factor of similar to 2, respectively. Combining the current sightlines with previously obtained Nai data from Kennedy et al. (1998b), the Na i/H i column density ratio over cluster sightlines varies by upto a factor of similar to 25, when using Hi data of resolution similar to 2 x 1 arcmin. One cluster star, M15 ZNG-1, was also observed in the Ca i (lambda(air) = 4226.728 Angstrom) and Ca ii (lambda(air) = 3933.663 Angstrom) lines. A column density ratio N(Ca i)/N(Ca ii) <0.03 was found, typical of values seen in the warm ionised interstellar medium. Towards this sightline, the IVC has a Nai/Ca ii column density ratio of &SIM; 0.25, similar to that observed in the local interstellar medium. Finally, we detect tentative evidence for IV absorption in Ki (?(air) = 7698:974 &ANGS) towards 3 cluster stars, which have N(K i)/N(H i) ratios of &SIM;0.5-3 x 10(-9).
Resumo:
We describe medium-resolution spectroscopic observations taken with the ESO Multi-Mode Instrument (EMMI) in the CaII K line (lambda air = 3933.661 angstrom) towards 7 QSOs located in the line-of-sight to the Magellanic Bridge. At a spectral resolution R =lambda/Delta lambda = 6000, five of the sightlines have a signal-to-noise ( S/N) ratio of similar to 20 or higher. Definite Ca absorption due to Bridge material is detected towards 3 objects, with probable detection towards two other sightlines. Gas-phase CaII K Bridge and Milky Way abundances or lower limits for the all sightlines are estimated by the use of Parkes 21-cm H. emission line data. These data only have a spatial resolution of 14 arcmin compared with the optical observations which have milli-arcsecond resolution. With this caveat, for the three objects with sound CaII K detections, we find that the ionic abundance of CaII K relative to HI, A = log( N( CaK)/ N( HI)) for low- velocity Galactic gas ranges from - 8.3 to - 8.8 dex, with HI column densities varying from 3- 6 x 10(20) cm(-2). For Magellanic Bridge gas, the values of A are similar to 0.5 dex higher, ranging from similar to- 7.8 to - 8.2 dex, with N( HI) = 1- 5 x 1020 cm(-2). Higher values of A correspond to lower values of N( HI), although numbers are small. For the sightline towards B 0251 - 675, the Bridge gas has two different velocities, and in only one of these is CaII tentatively detected, perhaps indicating gas of a different origin or present-day characteristics ( such as dust content), although this conclusion is uncertain and there is the possibility that one of the components could be related to the Magellanic Stream. Higher signal-to-noise CaII K data and higher resolution H. data are required to determine whether A changes with N( HI) over the Bridge and if the implied difference in the metalicity of the two Bridge components towards B 0251-675 is real.
Resumo:
We present an analysis of interstellar NaI (lambda(air) = 3302.37 and 3302.98 angstrom), TiII (lambda(air) = 3383.76 angstrom) and CaII K (lambda(air) = 3933.66 angstrom) absorption features for 74 sightlines towards O- and B-type stars in the Galactic disc. The data were obtained from the Ultraviolet and Visual Echelle Spectrograph Paranal Observatory Project, at a spectral resolution of 3.75 km s(-1) and with mean signal-to-noise ratios per pixel of 260, 300 and 430 for the NaI, TiII and CaII observations, respectively. Interstellar features were detected in all but one of the TiII sightlines and all of the CaII sightlines. The dependence of the column density of these three species with distance, height relative to the Galactic plane, HI column density, reddening and depletion relative to the solar abundance has been investigated. We also examine the accuracy of using the NaI column density as an indicator of that for HI. In general, we find similar strong correlations for both Ti and Ca, and weaker correlations for Na. Our results confirm the general belief that Ti and Ca occur in the same regions of the interstellar medium ( ISM) and also that the TiII/CaII ratio is constant over all parameters. We hence conclude that the absorption properties of Ti and Ca are essentially constant under the general ISM conditions of the Galactic disc.
Resumo:
We present Ca II K (lambda(air) = 3933.661 angstrom) interstellar observations towards 20 early-type stars, to place lower distance limits to intermediate- and high-velocity clouds (IHVCs) in their lines of sight. The spectra are also employed to estimate the Ca abundance in the low-velocity gas towards these objects, when combined with Leiden-Dwingeloo 21-cm HI survey data of spatial resolution 0 degrees.5. Nine of the stars, which lie towards IHVC complexes H, K and gp, were observed with the intermediate dispersion spectrograph on the Isaac Newton Telescope at a resolution R = lambda/Delta lambda of 9000 (similar to 33 km s(-1)) and signal-to-noise ratio (S/N) per pixel of 75-140. A further nine objects were observed with the Utrecht Echelle Spectrograph on the William Herschel Telescope at R = 40 000 (similar to 7.5 km s(-1)) and S/N per pixel of 10-25. Finally, two objects were observed in both Ca II K and Na I D lines using the 2D COUDE on the McDonald 2.7-m telescope at R = 35 000 (similar to 8.5 km s(-1)). The abundance of Ca II K {log(10)(A) = log(10)[N(Ca II K)]-log(10)[N(HI)]} plotted against HI column density for the objects in the current sample with heights above the Galactic plane (z) exceeding 1000 pc is found to obey the Wakker & Mathis (2000) relation. Also, the reduced column density of Ca II K as function of z is consistent with the larger sample taken from Smoker et al. (2003). Higher S/N observations than those previously taken towards HVC complex H stars HD 13256 and HILT 190 reinforce the assertion that this lies at a distance exceeding 4000 pc. No obvious absorption is detected in observations of ALS 10407 and HD 357657 towards IVC complex gp. The latter star has a spectroscopically estimated distance of similar to 2040 pc, although this was derived assuming the star lies on the main sequence and without any reddening correction being applied. Finally, no Ca II K absorption is detected towards two stars along the line of sight to complex K, namely PG 1610+529 and PG 1710+490. The latter is at a distance of similar to 700 pc, hence placing a lower distance limit to this complex, where previously only an upper distance limit of 6800 pc was available.
Resumo:
Intense-field ionization of the hydrogen molecular ion by linearly polarized light is modelled by direct solution of the fixed-nuclei time-dependent Schrodinger equation and compared with recent experiments. Parallel transitions are calculated using algorithms which exploit massively parallel computers. We identify and calculate dynamic tunnelling ionization resonances that depend on laser wavelength and intensity, and molecular bond length. Results for lambda similar to 1064 nm are consistent with static tunnelling ionization. At shorter wavelengths lambda similar to 790 nm large dynamic corrections are observed. The results agree very well with recent experimental measurements of the ion spectra. Our results reproduce the single peak resonance and provide accurate ionization rate estimates at high intensities. At lower intensities our results confirm a double peak in the ionization rate as the bond length varies.
Resumo:
Thin film capacitor structures in which the dielectric is composed of superlattices of the relaxors [0.2Pb(Zn1/3Nb2/3)O- 3-0.8BaTiO(3)] and Pb(Mg1/3Nb2/3)O-3 have been fabricated by pulsed laser deposition. Superlattice wavelength (Lambda) was varied between similar to3 and similar to 600 nm, and dielectric properties were investigated as a function of Lambda. Progressive enhancement of the dielectric constant was observed on decreasing Lambda, and, in contrast to previous work, this was not associated with the onset of Maxwell-Wagner behavior. Polarization measurements as a function of temperature suggested that the observed enhancement in dielectric constant was associated with the onset of a coupled response. The superlattice wavelength (Lambda =20 nm) at which coupled functional behavior became apparent is comparable to that found in literature for the onset of coupled structural behavior (between Lambda =5 nm and Lambda =10 nm). (C) 2001 American Institute of Physics.
Resumo:
Surface plasmon polaritons (SPPs) are excited with light of wavelength lambda (1) = 632.8 nm on or near a gentle Ag/Ag step structure using focused beam, prism coupling and detected using a bare, sharpened fibre tip. The tip-sample separation is controlled by means of an evanescent optical field at wavelength lambda (2) = 543.5 nm in a photon scanning tunnelling microscope (PSTM). The SPP propagation properties are first characterised on both the thin and thick sections of the Ag film structure either side of the step, both macroscopically, using attenuated total reflection, and microscopically from the PSTM images; the two techniques yield very good agreement. It is found that the SPP propagation length is similar to 10-11 mum across the step in each direction (thick to thin and vice versa) as observed in the PSTM images. Thus, with reference to the propagation lengths of 14.2 and 11.7 mum for the thick and thin planar parts of the Ag film respectively, it is concluded that the SPPs negotiate the step reasonably successfully. Importantly, also, it is shown that images may be produced, displaying SPPs with either an artificially enhanced (similar to 15-20 mum) or truncated (5-8 mum) propagation length across the step. Consideration of such images leads us to suggest the possibility that the photon tunnelling occurs in a local water environment. (C) 2001 Elsevier Science B.V. All rights reserved.