Fully fluorinated imidodiphosphinate shells for visible- and NIR-Emitting lanthanides: Hitherto unexpected effects of sensitizer fluorination on lanthanide emission properties

In this paper we demonstrate that the effect of aromatic C-F substitution in ligands does not always abide by conventional wisdom for ligand design to enhance sensitisation for visible lanthanide emission, in contrast with NIR emission for which the same effect coupled with shell formation leads to unprecedented long luminescence lifetimes. We have chosen an imidodiphosphinate ligand, N-{P,P-di-(pentafluorophinoyl)}-P,P-dipentafluoro-phenylphosphinimidic acid (HF(20)tpip), to form ideal fluorinated shells about all visible- and NIR-emitting lanthanides. The shell, formed by three ligands, comprises twelve fully fluorinated aryl sensitiser groups, yet no-high energy X-H vibrations that quench lanthanide emission. The synthesis, full characterisation including X-ray and NMR analysis as well as the photophysical properties of the emissive complexes [Ln(F(20)tpip)(3)], in which Ln=Nd, Sm, Eu, Gd, Tb, Dy, Er, Yb, Y, Gd, are reported. The photophysical results contrast previous studies, in which fluorination of alkyl chains tends to lead to more emissive lanthanide complexes for both visible and NIR emission. Analysis of the fluorescence properties of the HF(20)tpip and [Gd(F(20)tpip)(3)] reveals that there is a low-lying state at around 715 nm that is responsible for partially quenching of the signal of the visible emitting lanthanides and we attribute it to a pi-sigma* state. However, all visible emitting lanthanides have long lifetimes and unexpectedly the [Dy(F(20)tpip)(3)] complex shows a lifetime of 0.3 ms, indicating that the elimination of high-energy vibrations from the ligand framework is particularly favourable for Dy. The NIR emitting lanthanides show strong emission signals in powder and solution with unprecedented lifetimes. The luminescence lifetimes of [Nd(F(20)tpip)(3)], [Er(F(20)tpip)(3)] and [Yb(F(20)tpip)(3)] in deuteurated acetonitrile are 44, 741 and 1111 mu s. The highest value observed for the [Yb(F(20)tpip)(3)] complex is more than half the value of the Yb ion radiative lifetime.

Intense near-infrared luminescence of anhydrous lanthanide(III) iodides in an imidazolium ionic liquid

Anhydrous neodymium(III) iodide and erbium(Ill) iodide were dissolved in carefully dried batches of the ionic liquid 1-dodecyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide, [C(12)mim][Tf2N]. Provided that the ionic liquid had a low water content, intense near-infrared emission could be observed for both the neodymium(III) ion and for the erbium(III) ion. Luminescence lifetimes have been measured, and the quantum yield of the neodymium(III) sample has been measured. Exposure of the hygroscopic samples to atmospheric moisture conditions caused a rapid decrease of the luminescence intensities. (C) 2004 Elsevier B.V. All rights reserved.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Decay of Cystalline Order and Equilibration during the Solid-to-Plasma Transition Induced by 20-fs Microfocused 92-eV Free-Electron-Laser Pulses

We have studied a solid-to-plasma transition by irradiating Al foils with the FLASH free electron laser at intensities up to 10(16) W/cm(2). Intense XUV self-emission shows spectral features that are consistent with emission from regions of high density, which go beyond single inner-shell photoionization of solids. Characteristic features of intrashell transitions allowed us to identify Auger heating of the electrons in the conduction band occurring immediately after the absorption of the XUV laser energy as the dominant mechanism. A simple model of a multicharge state inverse Auger effect is proposed to explain the target emission when the conduction band at solid density becomes more atomiclike as energy is transferred from the electrons to the ions. This allows one to determine, independent of plasma simulations, the electron temperature and density just after the decay of crystalline order and to characterize the early time evolution.

Dissociation of H2+ from a short, intense, infrared laser pulse: proton emission spectra and pulse calibration

The proton energy spectrum from photodissociation of the hydrogen molecular ion by short intense pulses of infrared light is calculated. The time-dependent Schrödinger equation is discretized and integrated. For few-cycle pulses one can resolve vibrational structure, arising from the experimental preparation of the molecular ion. We calculate the corresponding energy spectrum and analyse the dependence on the pulse time delay, pulse length and intensity of the laser for ? ~ 790 nm. We conclude that the proton spectrum is a sensitive probe of both the vibrational populations and phases, and allows us to distinguish between adiabatic and nonadiabatic dissociation. Furthermore, the sensitivity of the proton spectrum from H2+ is a practical means of calibrating the pulse. Our results are compared with recent measurements of the proton spectrum for 65 fs pulses using a Ti:Sapphire laser (? ~ 790 nm) including molecular orientation and focal-volume averaging. Integrating over the laser focal volume, for the intensity I ~ 3 × 1015 W cm-2, we find our results are in excellent agreement with these experiments.

Plasma emission spectroscopy of solids irradiated by intense XUV pulses from a free electron laser

The FLASH XUV-free electron laser has been used to irradiate solid samples at intensities of the order 10(16) W cm(-2) at a wavelength of 13.5 nm. The subsequent time integrated XUV emission was observed with a grating spectrometer. The electron temperature inferred from plasma line ratios was in the range 5-8 eV with electron density in the range 10(21)-10(22) cm(-3). These results are consistent with the saturation of absorption through bleaching of the L-edge by intense photo-absorption reported in an earlier publication. (C) 2009 Elsevier B.V. All rights reserved.

Visible and Near-Infrared Emission by Samarium(III)-Containing Ionic Liquid Mixtures

Highly luminescent anionic samarium(III) beta-diketonate and dipicolinate complexes were dissolved in the imidazolium ionic liquid 1-hexyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide, [C(6)mim][Tf2N]. The solubility of the complexes in the ionic liquid was ensured by a careful choice of the countercation of the samarium(III) complex. The samarium(III) complexes that were considered are [C(6)mim][SM(tta)(4)], where tta is 2-thenoyltrifluoroacetonate; [C(6)mim][Sm(nta)(4)], where nta is 2-naphthoyltrifluoroacetonate; [C(6)mim][Sm(hfa)(4)], where hfa is hexafluoroacetylacetonate; and [choline](3)-[Sm(dpa)(3)], where dpa is pyridine-2,6-dicarboxylate (dipicolinate) and [choline](+) is (2-hydroxyethyl)trimethyl ammonium. The crystal structures of the tetrakis samarium(III) P-diketonate complexes revealed a distorted square antiprismatic coordination for the samarium(III) ion in all three cases. Luminescence spectra were recorded for the samarium(III) complexes dissolved in the imidazolium ionic liquid as well as in a conventional solvent, that is, acetonitrile or water for the beta-diketonate and dipicolinate complexes, respectively. These experiments demonstrate that [C(6)mim][Tf2N] is a suitable spectroscopic solvent for studying samarium(III) luminescence. High-luminescence quantum yields were observed for the samarium(III) beta-diketonate complexes in solution.

Effect of relativistic plasma on extreme-ultraviolet harmonic emission from intense laser-matter interactions

Experiments were performed in which intense laser pulses (up to 9x10(19) W/cm(2)) were used to irradiate very thin (submicron) mass-limited aluminum foil targets. Such interactions generated high-order harmonic radiation (greater than the 25th order) which was detected at the rear of the target and which was significantly broadened, modulated, and depolarized because of passage through the dense relativistic plasma. The spectral modifications are shown to be due to the laser absorption into hot electrons and the subsequent sharply increasing relativistic electron component within the dense plasma.

Fast-electron refluxing effects on anisotropic hard-x-ray emission from intense laser-plasma interactions

Fast-electron generation and dynamics, including electron refluxing, is at the core of understanding high-intensity laser-plasma interactions. This field is itself of strong relevance to fast ignition fusion and the development of new short-pulse, intense, x-ray, gamma-ray, and particle sources. In this paper, we describe experiments that explicitly link fast-electron refluxing and anisotropy in hard-x-ray emission. We find the anisotropy in x-ray emission to be strongly correlated to the suppression of refluxing. In contrast to some previous work, the peak of emission is directly along the rear normal to the target rather than along either the incident laser direction or the specular reflection direction.

XUV Emission from Autoionizing Hole States Induced by Intense XUV-FEL at Intensities up to 10(17) W/cm(2)

Aluminium targets were irradiated with 92 eV radiation from FLASH Free Electron Laser at DESY at intensities up to 10(17)W/cm(2) by focussing the beam on target down to a spot size of similar to 1 mu m by means of a parabolic mirror. High resolution XUV spectroscopy was used to identify aluminium emission from complex hole-states. Simulations carried out with the MARIA code show that the emission characterizes the electron heating in the transition phase solid-atomic. The analysis allows constructing a simple model of electron heating via Auger electrons.

Quantifying Aflatoxin B1 in peanut oil using fabricating fluorescence probes based on upconversion nanoparticles

Rare earth doped upconversion nanoparticles convert near-infrared excitation light into visible emission light. Compared to organic fluorophores and semiconducting nanoparticles, upconversion nanoparticles (UCNPs) offer high photochemical stability, sharp emission bandwidths, and large anti-Stokes shifts. Along with the significant light penetration depth and the absence of autofluorescence in biological samples under infrared excitation, these UCNPs have attracted more and more attention on toxin detection and biological labelling. Herein, the fluorescence probe based on UCNPs was developed for quantifying Aflatoxin B₁ (AFB₁) in peanut oil. Based on a specific immunity format, the detection limit for AFB₁ under optimal conditions was obtained as low as 0.2 ng·ml^{- 1}, and in the effective detection range 0.2 to 100 ng·ml^{- 1}, good relationship between fluorescence intensity and AFB₁ concentration was achieved under the linear ratios up to 0.90. Moreover, to check the feasibility of these probes on AFB₁ measurements in peanut oil, recovery tests have been carried out. A good accuracy rating (93.8%) was obtained in this study. Results showed that the nanoparticles can be successfully applied for sensing AFB₁ in peanut oil.

Evidence for rescattering in intense, femtosecond laser interactions with a negative ion

It is now well established that energetic electron emission, nonsequential ionization, and high harmonic generation, produced during the interaction of intense, femtosecond laser pulses with atoms (and atomic positive ions), can be explained by invoking rescattering of the active electron in the laser field, the so-called rescattering mechanism. In contrast for negative ions, the role of rescattering has not been established experimentally. By irradiating F- ions with ultrashort laser pulses, F+ ion yields as a function of intensity for both linearly and circularly polarized light have been measured. We find that, at intensities well below saturation for F+ production by sequential ionization, there is a small but significant enhancement in the yield for the case of linearly polarized light, providing the first clear experimental evidence for the existence of the rescattering mechanism in negative ions.

Intense-field dissociation dynamics of D2+ molecular ions using ultrafast laser pulses

The dynamics of dissociation of pre-ionized D2+ molecules using intense (10^12–10^15 W cm-2), ultrashort (50 fs), infrared (? = 790 nm) laser pulses are examined. Use of an intensity selective scan technique has allowed the deuterium energy spectrum to be measured over a broad range of intensity. It is found that the dominant emission shifts to lower energies as intensity is increased, in good agreement with corresponding wavepacket simulations. The results are consistent with an interpretation in terms of bond softening, which at high intensity (approximately >3 × 10^14 W cm-2) becomes dominated by dissociative ionization. Angular distribution measurements reveal the presence of slow molecular dissociation, an indication that vibrational trapping mechanisms occur in this molecule.

Rare-earth nitroquinolinates: Visible-light-sensitizable near-infrared emitters in aqueous solution

Water-soluble, stable, and easily synthesizable 1:4 complexes of rare-earth ions with 8-hydroxy-5-nitroquinolinate ligands have been prepared. These complexes can be sensitized by visible light with wavelengths up to 480 nm and show near-infrared emission in aqueous solution. The incorporation of a nitro group in the quinoline moiety shifts its absorption bands to longer wavelengths and also increases its molar absorptivity by a factor of 2.5, thereby significantly enhancing its light-harvesting power. The presence of the nitro group also increases the solubility of the resulting complexes, making them water-soluble. (c) Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, Germany, 2007.

Search for Rapid Changes in the Visible-Light Corona during the 21 June 2001 Total Solar Eclipse

Some 8000 images obtained with the Solar Eclipse Coronal Imaging System (SECIS) fast-frame CCD camera instrument located at Lusaka, Zambia, during the total eclipse of 21 June 2001 have been analysed to search for short-period oscillations in intensity that could be a signature of solar coronal heating mechanisms by MHD wave dissipation. Images were taken in white-light and Fe xiv green-line (5303 ) channels over 205 seconds (frame rate 39 s(-1)), approximately the length of eclipse totality at this location, with a pixel size of four arcseconds square. The data are of considerably better quality than those that we obtained during the 11 August 1999 total eclipse (Rudawy et al.: Astron. Astrophys. 416, 1179, 2004), in that the images are much better exposed and enhancements in the drive system of the heliostat used gave a much improved image stability. Classical Fourier and wavelet techniques have been used to analyse the emission at 29 518 locations, of which 10 714 had emission at reasonably high levels, searching for periodic fluctuations with periods in the range 0.1 -aEuro parts per thousand 17 seconds (frequencies 0.06 -aEuro parts per thousand 10 Hz). While a number of possible periodicities were apparent in the wavelet analysis, none of the spatially and time-limited periodicities in the local brightness curves was found to be physically important. This implies that the pervasive Alfv,n wave-like phenomena (Tomczyk et al.: Science 317, 1192, 2007) using polarimetric observations with the Coronal Multi-Channel Polarimeter (CoMP) instrument do not give rise to significant oscillatory intensity fluctuations.