Quantification of urinary excretion of ethosuximide enantiomers and their major metabolites in the rat.

A chiral gas chromatographic assay has been developed for quantitative analysis of ethosuximide and its major metabolites in rat urine. The extraction procedure was found to be precise and reproducible. Recovery was in the range of 94-98%, intraday CV(%) was 0.92% for (S)-ethosuximide (50 mug/ml) and 0.51% for (R)-ethosuximide (50 mug/ml). Interday CV(%) was 1.12% for (S)-ethosuximide and 0.72% for (R)-ethosuximide. The limit of detection was determined to be around 0.01 mug/ml for each enantiomer. Following administration of rac-ethosuximide by i.v., i.p. and oral routes, unchanged ethosuximide was detected in urine up to 72h after drug administration. The appearance of all detected metabolites occurred Within 24h of drug administration. Significantly more (S)-ethosuximide was excreted unchanged than (R)-ethosuximide with all three routes studied. A substantial amount of the drug was eliminated as the 2-(1-hydroxyethyl)-2-methylsuccinimide (2 pairs of diastereoisomers). Much less drug was eliminated as the 2-ethyl-3-hydroxy-2-methylsuccinimide with only one diastereoisomer observed. Examination of the one pair of diastereoisomers of 2-(1-hydroxyethyl)-2-methylsuccinimide that was resolved showed preferential excretion of one isomer. Comparison of both pairs of diastereoisomers showed that one pair was formed in preference to the other with a ratio of approximately 0.8:1. It is concluded that stereoselective metabolism of ethosuximide occurs. Copyright (C) 2001 John Wiley & Sons, Ltd. Author Keywords: chiral pharmacokinetics; ethosuximide enantiomers; metabolism; rat; urinary excretion; gas chromatography

Non-thiazolidinedione antihyperglycemic agents. Part 4: synthesis of ( )-, (R)-(+)- and (S)-(-)-enantiomers of 2-oxy-3-arylpropanoic acids

. Haigh, David; Birrell, Helen C.; Cantello, Barrie C. C.; Hindley, Richard M.; Ramaswamy, Anantha; Rami, Harshad K.; Stevens, Nicola C. Department of Medicinal Chemistry, SmithKline Beecham Pharmaceuticals, Essex, UK. Tetrahedron: Asymmetry (1999), 10(7), 1335-1351. Publisher: Elsevier Science Ltd., CODEN: TASYE3 ISSN: 0957-4166. Journal written in English. CAN 131:144536 AN 1999:369513 CAPLUS (Copyright (C) 2009 ACS on SciFinder (R)) Abstract The synthesis of a new series of potent 2-oxy-3-arylpropanoic acid antihyperglycemic agents in both racemic and non-racemic form is described. (the biol. activity of these compds. was not reported here). Resoln. of racemic acids is accomplished via amide formation with either (S)-2-phenylglycinol or (S)-4-benzyl-2-oxazolidinone as complementary resolving agents. The target compds. were ?-alkoxy-4-[2-[(2-benzoxazolyl)amino]ethoxy]benzenepropanoic acid derivs.

Interactions between pyrazole derived enantiomers and Chiralcel OJ: Prediction of enantiomer absolute configurations and elution order by molecular dynamics simulations

The separation of enantiomers and confirmation of their absolute configurations is significant in the development of chiral drugs. The interactions between the enantiomers of chiral pyrazole derivative and polysaccharide-based chiral stationary phase cellulose tris(4-methylbenzoate) (Chiralcel OJ) in seven solvents and under different temperature were studied using molecular dynamics simulations. The results show that solvent effect has remarkable influence on the interactions. Structure analysis discloses that the different interactions between two isomers and chiral stationary phase are dependent on the nature of solvents, which may invert the elution order. The computational method in the present study can be used to predict the elution order and the absolute configurations of enantiomers in HPLC separations and therefore would be valuable in development of chiral drugs.

Diastereotopic analysis of mesoridazine besylate (serentil)

NMR studies were conducted with the aim of determining the diastereoisomeric ratio of a commercially supplied sample of mesoridazine (MES) and to compare the results with a freshly synthesised sample of MES. The results indicated that the commercially supplied MES consisted almost entirely of one diastereoisomeric pair, which was in agreement with previous findings reported by Eap et al. (J Chromatogr 669:271-279, 1995). The synthesised sample of MES was analysed by NMR in two stages: 1) as the initial product isolated as the free base from the direct synthesis, and 2) as the free base isolated from the crystallised besylate salt of the synthetic product. The NMR results show that the initial synthetic product consisted of two equal pairs of diastereoisomers. The diastereoisomeric pairs were further separated by the addition of the chiral shift reagent (R)-(-)-N-(3,5 dinitrobenzoyl)-alpha-benzylamine to reveal equal quantities of all four enantiomers, clearly observed at the methyl sulfoxide proton peak of the NMR scan. The sample obtained from the crystallisation of MES besylate, however, indicated a significant difference, with a diastereoisomeric ratio of 75:25. The results suggest that MES besylate undergoes preferential crystallisation of one pair of diastereoisomers, with the other pair remaining in solution. (C) 2004 Wiley-Liss, Inc.

Enantiocomplementary preparation of (S)- and (R)-1-pyridylalkanols via ketone reduction and alkane hydroxylation using whole cells of Pseudomonas putida UV4

A previously unreported alcohol dehydrogenase enzyme in the mutant soil bacterium Pseudomonas putida UV4 catalyses the reduction of 2-, 3- and 4-acylpyridines to afford the corresponding (S)-1-pyridyl alkanols, with moderate to high e.e., whilst under the same conditions 2,6-diacetylpyridine is readily converted to the corresponding enantiopure C2-symmetric (S,S)-diol in one step. In contrast, the toluene dioxygenase enzyme in the same organism catalyses the hydroxylation of 2- and 3-alkylpyridines to (R)-1-(2-pyridyl) and (R)-1-(3-pyridyl)alkanols. This combination of oxidative and reductive biotransformations thus provides a method for preparing both enantiomers of chiral 1-pyridyl alkanols using one biocatalyst.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Facile Syntheses of Three Major Metabolites of Thioridazine

NMR studies were conducted with the aim of determining the diastereoisomeric ratio of a commercially supplied sample of mesoridazine (MES) and to compare the results with a freshly synthesised sample of MES. The results indicated that the commercially supplied MES consisted almost entirely of one diastereoisomeric pair, which was in agreement with previous findings reported by Eap et al. (J Chromatogr 669:271-279, 1995). The synthesised sample of MES was analysed by NMR in two stages: 1) as the initial product isolated as the free base from the direct synthesis, and 2) as the free base isolated from the crystallised besylate salt of the synthetic product. The NMR results show that the initial synthetic product consisted of two equal pairs of diastereoisomers. The diastereoisomeric pairs were further separated by the addition of the chiral shift reagent (R)-(-)-N-(3,5 dinitrobenzoyl)-alpha-benzylamine to reveal equal quantities of all four enantiomers, clearly observed at the methyl sulfoxide proton peak of the NMR scan. The sample obtained from the crystallisation of MES besylate, however, indicated a significant difference, with a diastereoisomeric ratio of 75:25. The results suggest that MES besylate undergoes preferential crystallisation of one pair of diastereoisomers, with the other pair remaining in solution. (C) 2004 Wiley-Liss, Inc.

Chemoenzymatic synthesis of trans-dihydrodiol derivatives of monosubstituted benzenes from the corresponding cis-dihydrodiol isomers

Enantiopure trans-dihydrodiols have been obtained by a chemoenzymatic synthesis from the corresponding cis-dihydrodiol metabolites, obtained by dioxygenase-catalysed arene cis-dihydroxylation at the 2,3-bond of monosubstituted benzene substrates. This generally applicable, seven-step synthetic route to trans-dihydrodiols involves a regioselective hydrogenation and a Mitsunobu inversion of configuration at C-2, followed by benzylic bromination and dehydrobromination steps. The method has also been extended to the synthesis of both enantiomers of the trans-dihydrodiol derivatives of toluene, through substitution of a vinyl bromine atom of the corresponding trans-dihydrodiol enantiomers derived from bromobenzene. Through incorporation of hydrogenolysis and diMTPA ester diastereoisomer resolution steps into the synthetic route, both trans-dihydrodiol enantiomers of monohalobenzenes were obtained from the cis-dihydrodiols of 4-haloiodobenzenes.

Selectivity studies of the benzene cis-dihydrodiol dehydrogenase enzyme from Pseudomonas putida ML2 with Vicinal diol substrates

The enantiopure (1S, 2S)-cis-dihydrodiol metabolites 2B-5B have been obtained in low yield from the corresponding monosubstituted halobenzene substrates 2A-5A, using a wild-type strain of Pseudomonas putida (ML2) containing benzene dioxygenase (BDO). Benzene cis-dihydrodiol dehydrogenase (BCD) from P. putida ML2 and naphthalene cis-dihydrodiol dehydrogenase (NCD) from P. putida 8859 were purified and used in a comparative study of the stereoselective biotransformation of cis-dihydrodiol enantiomers 2B-5B. The BCD and NCD enzymes were found to accept cis-dihydrodiol enantiomers of monosubstituted benzene cis-dihydrodiol substrates 2B-5B of opposite absolute configuration. The acyclic alkene 1,2-diols 10-17 were also found to be acceptable substrates for BCD.

Dioxygenase-catalysed mono-, di- and tri-oxygenation of dialkyl sulfides and thioacetals: chemoenzymatic synthesis of enantiopure cis-diol sulfoxides

Toluene dioxygenase (TDO)-catalysed monooxygenation of methylsulfanylmethyl phenyl sulfide 1 and methylsulfanylmethyl 2-pyridyl sulfide 4, using whole cells of Pseudomonas putida UV4, occurred exclusively at the alkyl aryl sulfur centre to yield the alkyl aryl sulfoxides 2 and 5 respectively. These sulfoxides, accompanied by the dialkyl sulfoxides 3 and 6, were also obtained from naphthalene dioxygenase (NDO)-catalysed sulfoxidation of thioacetals 1 and 4 using intact cells of P. putida NCIMB 8859. Enzymatic oxidation of methyl benzyl sulfide 7, 2-phenyl-1,3-dithiane 19, and 2-phenyl-1,3-dithiolane 23, using TDO, gave the corresponding dialkyl sulfoxides 8, 20 and 24 as minor bioproducts. TDO-catalysed dioxygenation of the alkyl benzyl sulfides 7, 15 and 17 and the thioacetals 19 and 23, with P. putida UV4, yielded the corresponding enantiopure cis-dihydrodiols 9, 16, 18, 21 and 25 as major metabolites and cis-dihydrodiol sulfoxides 14, 22 and 26 as minor metabolites, resulting from a tandem trioxygenation of substrates 7, 19 and 23 respectively. Chemical oxidation, of the enantiopure cis-dihydrodiol sulfides 9, 16, 18 and 21 with dimethyldioxirane (DMD), gave separable mixtures of the corresponding pairs of cis-dihydrodiol sulfoxide diastereoisomers 14 and 27, 28 and 29, 30 and 31, 22 and 32. While dialkyl sulfoxide bioproducts 3, 6, 20 and 24 were of variable enantiopurity (27-greater than or equal to 98% ee), alkyl aryl monosulfoxides 2 and 5, cis-dihydrodiols 9, 16, 18, 21 and 25 and cis-dihydrodiol sulfoxide bioproducts 14, 22 and 26 were all single enantiomers (greater than or equal to 98% ee). The absolute configurations of the products, obtained from enzyme-catalysed (TDO and NDO) and chemical (DMD) oxidation methods, were determined by stereochemical correlation, circular dichroism, and X-ray crystallographic methods.

syn-Benzene dioxides: chemoenzymatic synthesis from 2,3-cis-dihydrodiol derivatives of monosubstituted benzenes and their application in the synthesis of regioisomeric 1,2- and 3,4-cis-dihydrodiols and 1,4-dioxocins

cis-2,3-Dihydrodiol metabolites of monosubstituted halobenzenes and toluene have been used as synthetic precursors of the corresponding 3,4-cis-dihydrodiols. Enantiopure syn-benzene dioxide intermediates were reduced to the 3,4-cis-dihydrodiols and thermally racemised via the corresponding 1,4-dioxocins. The syn-benzene dioxide-1,4-dioxocin valence tautomeric equilibrium ratio was found to be dependent on the substituent position. The methodology has also been applied to the synthesis of both enantiomers of the 1,2-(ipso)- and 3,4-cis-dihydrodiols of toluene. This chemoenzymatic approach thus makes available, for the first time, all three possible cis-dihydrodiol regioisomers of a monosubstituted benzene.

Chemoenzymatic synthesis of the trans-dihydrodiol isomers of monosubstituted benzenes via anti-benzene dioxides

Enantiopure cis-2,3-dihydrodiols, available from dioxygenase-catalysed cis-dihydroxylation of monosubstituted benzene substrates, have been used as synthetic precursors of the corresponding trans-3,4-dihydrodiols. The six-step chemoenzymatic route from cis-dihydrodiol precursors, involving acetonide, tetraol, dibromodiacetate and diepoxide intermediates, and substitution of vinyl bromide and iodide atoms, has been used in the synthesis of ten trans-dihydrododiol derivatives of substituted benzenes. The general applicability of the method has been demonstrated by its use in the synthesis of both enantiomers of the trans-1,2- and 3,4-dihydrodiol derivatives of toluene.