Cells deficient in the base excision repair protein, DNA polymerase beta, are hypersensitive to oxaliplatin chemotherapy

A significant proportion of human cancers overexpress DNA polymerase beta (Pol beta), the major DNA polymerase involved in base excision repair. The underlying mechanism and biological consequences of overexpression of this protein are unknown. We examined whether Pol beta, expressed at levels found in tumor cells, is involved in the repair of DNA damage induced by oxaliplatin treatment and whether the expression status of this protein alters the sensitivity of cells to oxaliplatin. DNA damage induced by oxaliplatin treatment of HCT116 and HT29 colon cancer cells was observed to be associated with the stabilization of Pol beta protein on chromatin. In comparison with HCT116 colon cancer cells, isogenic oxaliplatin-resistant (HCT-OR) cells were found to have higher constitutive levels of Pol beta protein, faster in vitro repair of a DNA substrate containing a single nucleotide gap and faster repair of 1,2-GG oxaliplatin adduct levels in cells. In HCT-OR cells, small interfering RNA knockdown of Pol beta delayed the repair of oxaliplatin-induced DNA damage. In a different model system, Pol beta-deficient fibroblasts were less able to repair 1,2-GG oxaliplatin adducts and were hypersensitive to oxaliplatin treatment compared with isogenic Pol beta-expressing cells. Consistent with previous studies, Pol beta-deficient mouse fibroblasts were not hypersensitive to cisplatin treatment. These data provide the first link between oxaliplatin sensitivity and DNA repair involving Pol beta. They demonstrate that Pol beta modulates the sensitivity of cells to oxaliplatin treatment. Oncogene (2010) 29, 463-468; doi:10.1038/onc.2009.327; published online 19 October 2009

BRD7, a subunit of SWI/SNF complexes, binds directly to BRCA1 and regulates BRCA1-dependent transcription

We carried out a yeast two-hybrid screen using a BRCA1 bait composed of amino acids 1 to 1142 and identified BRD7 as a novel binding partner of BRCA1. This interaction was confirmed by coimmunoprecipitation of endogenous BRCA1 and BRD7 in T47D and HEK-293 cells. BRD7 is a bromodomain containing protein, which is a subunit of PBAF-specific Swi/Snf chromatin remodeling complexes. To determine the functional consequences of the BRCA1-BRD7 interaction, we investigated the role of BRD7 in BRCA1-dependent transcription using microarray-based expression profiling. We found that a variety of targets were coordinately regulated by BRCA1 and BRD7, such as estrogen receptor alpha (ERalpha). Depletion of BRD7 or BRCA1 in either T47D or MCF7 cells resulted in loss of expression of ERalpha at both the mRNA and protein level, and this loss of ERalpha was reflected in resistance to the antiestrogen drug fulvestrant. We show that BRD7 is present, along with BRCA1 and Oct-1, on the ESR1 promoter (the gene which encodes ERalpha). Depletion of BRD7 prevented the recruitment of BRCA1 and Oct-1 to the ESR1 promoter; however, it had no effect on the recruitment of the other Swi/Snf subunits BRG1, BAF155, and BAF57 or on RNA polymerase II recruitment. These results support a model whereby the regulation of ERalpha transcription by BRD7 is mediated by its recruitment of BRCA1 and Oct-1 to the ESR1 promoter.

Exome sequencing of gastric adenocarcinoma identifies recurrent somatic mutations in cell adhesion and chromatin remodelling genes

Gastric cancer is a major cause of global cancer mortality. We surveyed the spectrum of somatic alterations in gastric cancer by sequencing the exomes of 15 gastric adenocarcinomas and their matched normal DNAs. Frequently mutated genes in the adenocarcinomas included TP53 (11/15 tumors), PIK3CA (3/15) and ARID1A (3/15). Cell adhesion was the most enriched biological pathway among the frequently mutated genes. A prevalence screening confirmed mutations in FAT4, a cadherin family gene, in 5% of gastric cancers (6/110) and FAT4 genomic deletions in 4% (3/83) of gastric tumors. Frequent mutations in chromatin remodeling genes (ARID1A, MLL3 and MLL) also occurred in 47% of the gastric cancers. We detected ARID1A mutations in 8% of tumors (9/110), which were associated with concurrent PIK3CA mutations and microsatellite instability. In functional assays, we observed both FAT4 and ARID1A to exert tumor-suppressor activity. Somatic inactivation of FAT4 and ARID1A may thus be key tumorigenic events in a subset of gastric cancers.

A novel fluorescence-based assay for the rapid detection and quantification of cellular deoxyribonucleoside triphosphates

Current methods for measuring deoxyribonucleoside triphosphates (dNTPs) employ reagent and labor-intensive assays utilizing radioisotopes in DNA polymerase-based assays and/or chromatography-based approaches. We have developed a rapid and sensitive 96-well fluorescence-based assay to quantify cellular dNTPs utilizing a standard real-time PCR thermocycler. This assay relies on the principle that incorporation of a limiting dNTP is required for primer-extension and Taq polymerase-mediated 5-3' exonuclease hydrolysis of a dual-quenched fluorophore-labeled probe resulting in fluorescence. The concentration of limiting dNTP is directly proportional to the fluorescence generated. The assay demonstrated excellent linearity (R(2) > 0.99) and can be modified to detect between ∼0.5 and 100 pmol of dNTP. The limits of detection (LOD) and quantification (LOQ) for all dNTPs were defined as <0.77 and <1.3 pmol, respectively. The intra-assay and inter-assay variation coefficients were determined to be <4.6% and <10%, respectively with an accuracy of 100 ± 15% for all dNTPs. The assay quantified intracellular dNTPs with similar results obtained from a validated LC-MS/MS approach and successfully measured quantitative differences in dNTP pools in human cancer cells treated with inhibitors of thymidylate metabolism. This assay has important application in research that investigates the influence of pathological conditions or pharmacological agents on dNTP biosynthesis and regulation.

Quantitative regulation of FLC via coordinated transcriptional initiation and elongation

The basis of quantitative regulation of gene expression is still poorly understood. In Arabidopsis thaliana, quantitative variation in expression of FLOWERING LOCUS C (FLC) influences the timing of flowering. In ambient temperatures, FLC expression is quantitatively modulated by a chromatin silencing mechanism involving alternative polyadenylation of antisense transcripts. Investigation of this mechanism unexpectedly showed that RNA polymerase II (Pol II) occupancy changes at FLC did not reflect RNA fold changes. Mathematical modeling of these transcriptional dynamics predicted a tight coordination of transcriptional initiation and elongation. This prediction was validated by detailed measurements of total and chromatin-bound FLC intronic RNA, a methodology appropriate for analyzing elongation rate changes in a range of organisms. Transcription initiation was found to vary ∼ 25-fold with elongation rate varying ∼ 8- to 12-fold. Premature sense transcript termination contributed very little to expression differences. This quantitative variation in transcription was coincident with variation in H3K36me3 and H3K4me2 over the FLC gene body. We propose different chromatin states coordinately influence transcriptional initiation and elongation rates and that this coordination is likely to be a general feature of quantitative gene regulation in a chromatin context.

Topoisomerase IIα promotes activation of RNA polymerase I transcription by facilitating pre-initiation complex formation

Type II DNA topoisomerases catalyse DNA double-strand cleavage, passage and re-ligation to effect topological changes. There is considerable interest in elucidating topoisomerase II roles, particularly as these proteins are targets for anti-cancer drugs. Here we uncover a role for topoisomerase IIa in RNA polymerase I-directed ribosomal RNA gene transcription, which drives cell growth and proliferation and is upregulated in cancer cells. Our data suggest that topoisomerase IIa is a component of the initiation-competent RNA polymerase Iß complex and interacts directly with RNA polymerase I-associated transcription factor RRN3, which targets the polymerase to promoter-bound SL1 in pre-initiation complex formation. In cells, activation of rDNA transcription is reduced by inhibition or depletion of topoisomerase II, and this is accompanied by reduced transient double-strand DNA cleavage in the rDNA-promoter region and reduced pre-initiation complex formation. We propose that topoisomerase IIa functions in RNA polymerase I transcription to produce topological changes at the rDNA promoter that facilitate efficient de novo pre-initiation complex formation.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Vasoactivity of AG014699, a clinically active small molecule inhibitor of poly(ADP-ribose) polymerase: a contributory factor to chemopotentiation in vivo?

Purpose: Poly(ADP-ribose) polymerase (PARP) plays an important role in DNA repair, and PARP inhibitors can enhance the activity of DNA-damaging agents in vitro and in vivo. AG014699 is a potent PARP inhibitor in phase II clinical development. However, the range of therapeutics with which AG014699 could interact via a DNA-repair based mechanism is limited. We aimed to investigate a novel, vascular-based activity of AG014699, underlying in vivo chemosensitization, which could widen its clinical application.

Experimental Design: Temozolomide response was analyzed in vitro and in vivo. Vessel dynamics were monitored using “mismatch” following the administration of perfusion markers and real-time analysis of fluorescently labeled albumin uptake in to tumors established in dorsal window chambers. Further mechanistic investigations used ex vivo assays of vascular smooth muscle relaxation, gut motility, and myosin light chain kinase (MLCK) inhibition.

Results: AG014699 failed to sensitize SW620 cells to temozolomide in vitro but induced pronounced enhancement in vivo. AG014699 (1 mg/kg) improved tumor perfusion comparably with the control agents nicotinamide (1 g/kg) and AG14361 (forerunner to AG014699; 10 mg/kg). AG014699 and AG14361 relaxed preconstricted vascular smooth muscle more potently than the standard agent, hydralazine, with no impact on gut motility. AG014699 inhibited MLCK at concentrations that relaxed isolated arteries, whereas AG14361 had no effect.

Conclusion: Increased vessel perfusion elicited by AG014699 could increase tumor drug accumulation and therapeutic response. Vasoactive concentrations of AG014699 do not cause detrimental side effects to gut motility and may increase the range of therapeutics with which AG014699 could be combined with for clinical benefit.

Variation of strand break yield for plasmid DNA irradiated with high-Z metal nanoparticles.

PURPOSE: Poly(ADP-ribose) polymerase (PARP) plays an important role in DNA repair, and PARP inhibitors can enhance the activity of DNA-damaging agents in vitro and in vivo. AG014699 is a potent PARP inhibitor in phase II clinical development. However, the range of therapeutics with which AG014699 could interact via a DNA-repair based mechanism is limited. We aimed to investigate a novel, vascular-based activity of AG014699, underlying in vivo chemosensitization, which could widen its clinical application. EXPERIMENTAL DESIGN: Temozolomide response was analyzed in vitro and in vivo. Vessel dynamics were monitored using "mismatch" following the administration of perfusion markers and real-time analysis of fluorescently labeled albumin uptake in to tumors established in dorsal window chambers. Further mechanistic investigations used ex vivo assays of vascular smooth muscle relaxation, gut motility, and myosin light chain kinase (MLCK) inhibition. RESULTS: AG014699 failed to sensitize SW620 cells to temozolomide in vitro but induced pronounced enhancement in vivo. AG014699 (1 mg/kg) improved tumor perfusion comparably with the control agents nicotinamide (1 g/kg) and AG14361 (forerunner to AG014699; 10 mg/kg). AG014699 and AG14361 relaxed preconstricted vascular smooth muscle more potently than the standard agent, hydralazine, with no impact on gut motility. AG014699 inhibited MLCK at concentrations that relaxed isolated arteries, whereas AG14361 had no effect. CONCLUSION: Increased vessel perfusion elicited by AG014699 could increase tumor drug accumulation and therapeutic response. Vasoactive concentrations of AG014699 do not cause detrimental side effects to gut motility and may increase the range of therapeutics with which AG014699 could be combined with for clinical benefi

Resonance Raman probing of the interaction between dipyridophenazine complexes of Ru(II) and DNA

Resonance Raman (RR) spectroscopy has been used to probe the interaction between dipyridophenazine (dppz) complexes of ruthenium(II), [Ru(L)(2)(dppz)](2+) (L = 1,10-phenanthroline (1) and 2,2-bipyridyl (2)), and calf-thymus DNA. Ground electronic state RR spectra at selected probe wavelengths reveal enhancement patterns which reflect perturbation of the dppz-centered electronic transitions in the UV-vis spectra in the presence of DNA. Comparison of the RR spectra recorded of the short-lived MLCT excited states of both complexes in aqueous solution with those of the longer-lived states of the complexes in the DNA environment reveals changes to excited state modes, suggesting perturbation of electronic transitions of the dppz ligand in the excited state as a result of intercalation. The most prominent feature, at 1526 cm(-1), appears in the spectra of both 1 and 2 and is a convenient marker band for intercalation. For 1, the excited state studies have been extended to the A and A enantiomers. The marker band appears at the same frequency for both but with different relative intensities. This is interpreted as reflecting the distinctive response of the enantiomers to the chiral environment of the DNA binding sites. The results, together with some analogous data for other potentially intercalating complexes, are considered in relation to the more general application of time-resolved RR spectroscopy for investigation of intercalative interactions of photoexcited metal complexes with DNA.

Resonance-Raman probing of the interaction between dipyridophenazine complexes of ruthenium(II) and DNA

The resonance-Raman spectroscopic technique is an effective probe of the interaction between dipyridophenazine (dppz) complexes of ruthenium(II) and calf-thymus DNA, providing evidence that DNA addition results in changes to electronic transitions of the intercalating dppz ligand in both ground and excited states.