Increased concentrations of the oxidative DNA adduct 7, 8-dihydro-8-oxo-2-deoxyguanosine in the germ-line of men with type 1 diabetes

The effects of diabetes mellitus on male reproductive health have not been clearly defined. A previous publication from this group reported significantly higher levels of nuclear DNA fragmentation and mitochondrial DNA deletions in spermatozoa from men with type 1 diabetes. This study compared semen profiles, sperm DNA fragmentation and levels of oxidative DNA modification in spermatozoa of diabetic and non-diabetic men. Semen samples from 12 non-diabetic, fertile men and 11 type 1 diabetics were obtained and subjected to conventional light microscopic semen analysis. Nuclear DNA fragmentation was assessed using an alkaline Comet assay and concentrations of 7,8-dihydro-8-oxo-2-deoxyguanosine (8-OHdG), an oxidative adduct of the purine guanosine, were assessed by high-performance liquid chromatography. Conventional semen profiles were similar in both groups, whilst spermatozoa from type 1 diabetics showed significantly higher levels of DNA fragmentation (44% versus 27%; P < 0.05) and concentrations of 8-OHdG (3.6 versus 2.0 molecules of 8-OHdG per 105 molecules of deoxyguanosine; P < 0.05). Furthermore, a positive correlation was observed between DNA fragmentation and concentrations of 8-OHdG per 105 molecules of deoxyguanosine (rs = 0.7, P < 0.05). The genomic damage evident in spermatozoa of type 1 diabetics may have important implications for their fertility and the outcome of pregnancies fathered by these individuals.

1,3-dimethylimidazolium-2-carboxylate: the unexpected synthesis of an ionic liquid precursor and carbene-CO2 adduct

1,3-Dimethylimidazolium-2-carboxylate is formed in good yield, rather than the anticipated organic salt, 1,3-dimethylimidazolium methyl carbonate, as the reaction product resulting from both N-alkylation and C-carboxylation of 1-methylimidazole with dimethyl carbonate; the crystal structure of the zwitterion exhibits pi-stacked rings and two-dimensional sheets constructed by hydrogen-bonds from imidazolium-ring hydrogens to the carboxylate group.

Multisubstrate adduct inhibitors: Drug design and biological tools

In drug discovery, different methods exist to create new inhibitors possessing satisfactory biological activity. The multisubstrate adduct inhibitor (MAI) approach is one of these methods, which consists of a covalent combination between analogs of the substrate and the cofactor or of the multiple substrates used by the target enzyme. Adopted as the first line of investigation for many enzymes, this method has brought insights into the enzymatic mechanism, structure, and inhibitory requirements. In this review, the MAI approach, applied to different classes of enzyme, is reported from the point of view of biological activity.

Diabetes-related adduct formation and retinopathy

The pathogenesis of diabetic retinopathy is complex, reflecting the array of systemic and tissue-specific metabolic abnormalities. A range of pathogenic pathways are directly linked to hyperglycaemia and dyslipidaemia, and the retina appears to be exquisitely sensitive to damage. Establishing the biochemical and molecular basis for this pathology remains an important research focus. This review concentrates on the formation of a range of protein adducts that form after exposure to modifying intermediates known to be elevated during diabetes. These so-called advanced glycation end products (AGEs) and advanced lipoxidation end products (ALEs) are thought to play an important role in the initiation and progression of diabetic retinopathy, and mechanisms leading to dysfunction and death of various retinal cells are becoming understood. Perspective is provided on AGE/ALE formation in the retina and the impact that such adducts have on retinal cell function. There will be emphasis placed on the role of the receptor for AGEs and how this may modulate retinal pathology, especially in relation to oxidative stress and inflammation. The review will conclude by discussion of strategies to inhibit AGE/ALE formation or harmful receptor interactions in order to prevent disease progression from the point of diabetes diagnosis to sight-threatening proliferative diabetic retinopathy and diabetic macular oedema.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Demonstration of glycated insulin in human diabetic plasma and decreased biological activity assessed by euglycemic-hyperinsulinemic clamp technique in humans

The presence and biological significance of circulating glycated insulin has been evaluated by high-pressure liquid chromatography (HPLC), electrospray ionization mass spectrometry (ESI-MS), radioimmunoassay (RIA), receptor binding, and hyperinsulinemic-euglycemic clamp techniques. ESI-MS analysis of an HPLC-purified plasma pool from four male type 2 diabetic subjects (HbA(1e) 8.1 +/- 0.2%, plasma glucose 8.7 +/- 1.3 mmol/l [means +/- SE]) revealed two major insulin-like peaks with retention times of 14-16 min. After spectral averaging, the peak with retention time of 14.32 min exhibited a prominent triply charged (M+3H)(3+) species at 1,991.1 m/z, representing monoglycated insulin with an intact M-r of 5,970.3 Da. The second peak (retention time 15.70 min) corresponded to native insulin (M-r 5,807.6 Da), with the difference between the two peptides (162.7 Da) representing a single glucitol adduct (theoretical 164 Da). Measurement of glycated insulin in plasma of type 2 diabetic subjects by specific RIA gave circulating levels of 10.1 +/- 2.3 pmol/l, corresponding to -9% total insulin. Biological activity of pure synthetic monoglycated insulin (insulin B-chain Phe(1)-glucitol adduct) was evaluated in seven overnight-fasted healthy nonobese male volunteers using two-step euglycemic-hyperinsulinemic clamps (2 h at 16.6 mug (.) kg(-1) (.) min(-1), followed by 2 h at 83.0 mug (.) kg(-1) (.) min(-1); corresponding to 0.4 and 2.0 mU (.) kg(-1) (.) min(-1)). At the lower dose, the exogenons glucose infusion rates required to maintain euglycemia during steady state were significantly lower with glycated insulin (P

Lanthanide-containing metallomesogens with low transition temperatures

Lanthanide-containing liquid crystals exhibiting a mesophase close to room temperature were obtained by adduct formation between a long-chain salicylaldimine Schiff base and tris(2-thenoyltrifluoroacetonato)lanthanide( III) complexes or tris( benzoyltrifluoroacetonato) lanthanide( III) complexes. The mesophase was identified as a smectic A phase. The temperature range of the mesophase was found to decrease over the lanthanide series, and no mesophase was observed for the complexes of the smallest lanthanide ions. The photoluminescence of the europium( III), samarium( III), neodymium( III), and erbium( III) complexes was studied. It is shown that the clearing point can be detected by monitoring the luminescence decay time as a function of the temperature.

Rhodium carbenoid O-H insertion reactions with phenols; a facile method for the synthesis of trialkyl 2-aryloxyphosphonoacetates and their use in the preparation of 2-aryloxy-3-phenylpropanoates

Substituted phenols undergo a facile Rh carbenoid-mediated O-H insertion reaction with (EtO)2P(O)C(:N2)CO2R (I; R = Et, Me) to give 44-86% 2-aryloxyphosphonoacetates II (R1 = e.g., H, 4-Me, 4-Cl, 2-OH, 4-PhCH2O). Phenols contg. strongly electron withdrawing groups, bulky ortho-substituents or certain ortho-heteroatom substituents show reduced or variable yields. Catechol affords a mono-adduct which cyclizes to lactate III. Aniline inserts preferentially and exclusively over phenol in a competition reaction with I (R = Et) to give (EtO)2P(O)CH(NHPh)CO2Et. II are versatile intermediates in a prepn. of 2-aryloxy-3-phenylpropenoates IV by Wadsworth-Emmons reaction with benzaldehydes R2C6H4CHO (R2 = PhCH2O, 2-Cl, H). Dissolving Mg metal redn. provides a mild method for the conversion of propenoates IV into the corresponding propanoates.

A short synthesis of (+) and (−)-falcarinol

A short, practical synthesis of the bis-acetylenic natural product falcarinol 1 is reported. This method relies on the alternate functionalisation of bis-trimethylsilylbutadiyne 10. This may be achieved in one-pot, however, better yields were obtained more conventionally. Lipase mediated enzymatic kinetic resolution of the racemic adduct in an organic solvent afforded (+)-1 in 97% enantiomeric excess. The analogous process performed with racemic 3-acetoxy falcarinol 11 under aqueous conditions gave (-)-1. Oxidation of 1 with Dess–Martin periodinane gave falcarinone 2.

Cells deficient in the base excision repair protein, DNA polymerase beta, are hypersensitive to oxaliplatin chemotherapy

A significant proportion of human cancers overexpress DNA polymerase beta (Pol beta), the major DNA polymerase involved in base excision repair. The underlying mechanism and biological consequences of overexpression of this protein are unknown. We examined whether Pol beta, expressed at levels found in tumor cells, is involved in the repair of DNA damage induced by oxaliplatin treatment and whether the expression status of this protein alters the sensitivity of cells to oxaliplatin. DNA damage induced by oxaliplatin treatment of HCT116 and HT29 colon cancer cells was observed to be associated with the stabilization of Pol beta protein on chromatin. In comparison with HCT116 colon cancer cells, isogenic oxaliplatin-resistant (HCT-OR) cells were found to have higher constitutive levels of Pol beta protein, faster in vitro repair of a DNA substrate containing a single nucleotide gap and faster repair of 1,2-GG oxaliplatin adduct levels in cells. In HCT-OR cells, small interfering RNA knockdown of Pol beta delayed the repair of oxaliplatin-induced DNA damage. In a different model system, Pol beta-deficient fibroblasts were less able to repair 1,2-GG oxaliplatin adducts and were hypersensitive to oxaliplatin treatment compared with isogenic Pol beta-expressing cells. Consistent with previous studies, Pol beta-deficient mouse fibroblasts were not hypersensitive to cisplatin treatment. These data provide the first link between oxaliplatin sensitivity and DNA repair involving Pol beta. They demonstrate that Pol beta modulates the sensitivity of cells to oxaliplatin treatment. Oncogene (2010) 29, 463-468; doi:10.1038/onc.2009.327; published online 19 October 2009

The Structural and Molecular Biology of Type I Galactosemia: Enzymology of Galactose 1-phosphate Uridylyltransferase

Reduced galactose 1-phosphate uridylyltransferase (GAIT) activity is associated with the genetic disease type 1 galactosemia. This results in an increase in the cellular concentration of galactose 1-phosphate. The accumulation of this toxic metabolite, combined with aberrant glycoprotein and glycolipid biosynthesis, is likely to be the major factor in molecular pathology. The mechanism of GAIT was established through classical enzymological methods to be a substituted enzyme in which the reaction with UDP-glucose results in the formation of a covalent, UMP-histidine adduct in the active site. The uridylated enzyme can then react with galactose 1-phosphate to form UDP-galactose. The structure of the enzyme from Escherichia coli reveals a homodimer containing one zinc (II) and one iron (11) ion per subunit. This enzymological and structural knowledge provides the basis for understanding the biochemistry of this critical step in the Leloir pathway. However, a high-resolution crystal structure of human GAIT is required to assist greater understanding of the effects of disease-associated mutations. (C) 2011 IUBMB IUBMB Life, 63(9): 694-700, 2011

Protection against methylglyoxal-derived AGEs by regulation of glyoxalase 1 prevents retinal neuroglial and vasodegenerative pathology.

Aims/hypothesis
Methylglyoxal (MG) is an important precursor for AGEs. Normally, MG is detoxified by the glyoxalase (GLO) enzyme system (including component enzymes GLO1 and GLO2). Enhanced glycolytic metabolism in many cells during diabetes may overpower detoxification capacity and lead to AGE-related pathology. Using a transgenic rat model that overexpresses GLO1, we investigated if this enzyme can inhibit retinal AGE formation and prevent key lesions of diabetic retinopathy.
Methods
Transgenic rats were developed by overexpression of full length GLO1. Diabetes was induced in wild-type (WT) and GLO1 rats and the animals were killed after 12 or 24 weeks of hyperglycaemia. N e-(Carboxyethyl)lysine (CEL), N e-(carboxymethyl)lysine (CML) and MG-derived-hydroimidazalone-1 (MG-H1) were determined by immunohistochemistry and by ultra-performance liquid chromatography tandem mass spectrometry (UPLC-MSMS). Müller glia dysfunction was determined by glial fibrillary acidic protein (GFAP) immunoreactivity and by spatial localisation of the potassium channel Kir4.1. Acellular capillaries were quantified in retinal flat mounts.
Results
GLO1 overexpression prevented CEL and MG-H1 accumulation in the diabetic retina when compared with WT diabetic counterparts (p?<?0.01). Diabetes-related increases in Müller glial GFAP levels and loss of Kir4.1 at the vascular end-feet were significantly prevented by GLO1 overexpression (p?<?0.05) at both 12- and 24-week time points. GLO1 diabetic animals showed fewer acellular capillaries than WT diabetic animals (p?<?0.001) at 24 weeks’ diabetes.
Conclusions/interpretation
Detoxification of MG reduces AGE adduct accumulation, which, in turn, can prevent formation of key retinal neuroglial and vascular lesions as diabetes progresses. MG-derived AGEs play an important role in diabetic retinopathy.

Effect of alkali on methylene blue (CI Basic Blue 9) and other thiazine dyes

A detailed study of the action of alkali on methylene blue (Cl. Basic Blue 9) and other thiazine dyes was carried out through a combination of UV/visible spectroscopy, thin layer chromatography, mass and NMR spectrometry and computational methods. In 0.1 M aq alkali solution, methylene blue forms a highly coloured, lipophilic species that is mainly Bernthsen's methylene violet i.e. a hydrolysis decomposition product, this being contrary to the report of a red N-hydroxy methylene blue adduct. The nature of the heterocyclic nitrogen atom in C.I. Basic Blue 9 is discussed and it is concluded there is no basis for the proposal of nucleophile addition at this site of the dye. In contrast, other thiazine dyes are deprotonated by alkali to form their neutral, highly coloured, lipophilic conjugate base forms. (C) 2010 Elsevier Ltd. All rights reserved.

Aflatoxin Exposure May Contribute to Chronic Hepatomegaly in Kenyan School Children

BACKGROUND: Presentation with a firm type of chronic hepatomegaly of multifactorial etiology is common among school-age children in sub-Saharan Africa.

OBJECTIVE: Aflatoxin is a liver toxin and carcinogen contaminating staple maize food. In this study we examined its role in chronic hepatomegaly.

METHODS: Plasma samples collected in 2002 and again in 2004 from 218 children attending two schools in neighboring villages were assayed for aflatoxin exposure using the aflatoxin-albumin adduct (AF-alb) biomarker. Data were previously examined for associations among hepatomegaly, malaria, and schistosomiasis.

RESULTS: AF-alb levels were high in children from both schools, but the geometric mean (95% confidence interval) in year 2002 was significantly higher in Matangini [206.5 (175.5, 243.0) pg/mg albumin] than in Yumbuni [73.2 (61.6, 87.0) pg/mg; p < 0.001]. AF-alb levels also were higher in children with firm hepatomegaly [176.6 (129.6, 240.7) pg/mg] than in normal children [79.9 (49.6, 128.7) pg/mg; p = 0.029]. After adjusting for Schistosoma mansoni and Plasmodium infection, we estimated a significant 43% increase in the prevalence of hepatomegaly/hepatosplenomegaly for every natural-log-unit increase in AF-alb. In 2004, AF-alb levels were markedly higher than in 2002 [539.7 (463.3, 628.7) vs. 114.5 (99.7, 131.4) pg/mg; p < 0.001] but with no significant difference between the villages or between hepatomegaly and normal groups [539.7 (436.7, 666.9) vs. 512.6 (297.3, 883.8) pg/mg], possibly because acute exposures during an aflatoxicosis outbreak in 2004 may have masked any potential underlying relationship.

CONCLUSIONS: Exposure to aflatoxin was associated with childhood chronic hepatomegaly in 2002. These preliminary data suggest an additional health risk that may be related to aflatoxin exposure in children, a hypothesis that merits further testing.

TP53 R249S Mutations, Exposure to Aflatoxin, and Occurrence of Hepatocellular Carcinoma in a Cohort of Chronic Hepatitis B Virus Carriers from Qidong, China

Hepatocellular carcinoma (HCC) has a high mortality in East Asia and Sub-Saharan Africa, two regions where the main etiologic factors are chronic infections with hepatitis B vir-us and dietary exposure to aflatoxin. A single base substitution at the third nucleotide of codon 249 of TP53 (R249S) is common in HCC in these regions and has been associated with aflatoxin-DNA adducts. To determine whether R249S may be detected in plasma DNA before HCC diagnosis, we conducted a case-control study nested in a cohort of adult chronic hepatitis B virus carriers from Qidong County, People's Republic of China. Of the 234 plasma specimens that yielded adequate DNA, only 2 (0.9%) were positive for R249S by restriction fragment length polymorphisms, and both of them were controls. Of the 249 subjects tested for aflatoxin-albumin adducts, 168 (67%) were positive, with equal distribution between cases and controls. Aflatoxin-albumin adduct levels were low in the study, suggesting an overall low ongoing exposure to aflatoxin in this cohort. The R249S mutation was detected in 11 of 18 (61%) available tumor tissues. To assess whether low levels of mutant DNA were detectable in pre-diagnosis plasma, 14 plasma specimens from these patients were analyzed by short oligonucleotide mass analysis. Nine of them (64%) were found to be positive. Overall, these results suggest that HCC containing R249S can occur in the absence of significant recent exposure to aflatoxins. The use of short oligonucleotide mass analysis in the context of low ongoing aflatoxin exposure may allow the detection of R249S in plasma several months ahead of clinical diagnosis. (Cancer Epidemiol Biomarkers Prev 2009;18(5):1638-43)