Properties of SEPT9 Isoforms and the requirement for GTP binding

Members of the evolutionarily conserved septin family of genes are emerging as key components of several cellular processes including membrane trafficking, cytokinesis, and cell-cycle control events. SEPT9 has been shown to have a complex genomic architecture, such that up to 15 different isoforms are possible by the shuffling of five alternate amino termini and three alternate carboxy termini. Genomic and transcriptional alterations of SEPT9 have been associated with neoplasia. The present study has used a Sept9-specific antibody to determine the pattern of isoform expression in a range of tumour cell lines. Western blot analysis indicated considerable variation in the relative amounts and isoform content of Sept9. Immunofluorescence studies showed a range of patterns of cytoplasmic localization ranging from mainly particulate to mainly filamentous. Expression constructs were also generated for each amino terminal isoform to investigate the patterns of localization of individual isoforms and the effects on cells of ectopic expression. The present study shows that the epsilon isoform appears filamentous in this overexpression system while the remaining isoforms are particulate and cytoplasmic. Transient transfection of individual constructs into tumour cell lines results in cell-cycle perturbation with a G2/M arrest and dramatic growth suppression, which was greatest in cell lines with the lowest amounts of endogenous Sept9. Similar phenotypic observations were made with GTP-binding mutants of all five N-terminal variants of Sept9. However, dramatic differences were observed in the kinetics of accumulation of wild-type versus mutant septin protein in transfected cells. In conclusion, the present study shows that the expression patterns of Sept9 protein are very varied in a panel of tumour cell lines and the functional studies are consistent with a model of septin function as a component of a molecular scaffold that contributes to diverse cellular functions. Alterations in the levels of Sept9 protein by overexpression of individual isoforms can clearly perturb cellular behaviour and may thus provide a mechanistic explanation for observations of deranged septin expression in neoplasia. Copyright © 2004 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Characterization of a ligand-attenuated binding site on glycoprotein IIb/IIIa

We describe an epitope on the platelet integrin, GPIIb/IIIa, identified by the monoclonal antibody, 4F8, which is attenuated by small-molecule GPIIb/IIIa ligands. 4F8 did not bind to the ligand binding pocket as it did not compete with a radiolabelled antagonist, H-3-SC-52012. This indicates that the 4F8 epitope behaves as a ligand-attenuated binding site (LABS). Ligand-induced attenuation of 4178 was an active process as it was prevented by pretreating platelets with cytochalasin D and reduced by prostaglandin E-1 or inhibition of protein kinase C. Disappearance of the epitope was required for full platelet activation as 4F8 prevented platelet aggregation without inhibiting fibrinogen binding. These results suggest a model where disappearance of the 4F8 epitope is a secondary event required for full

A 3-D well-differentiated model of pediatric bronchial epithelium demonstrates unstimulated morphological differences between asthmatic and nonasthmatic cells

There is a need for reproducible and effective models of pediatric bronchial epithelium to study disease states such as asthma. We aimed to develop, characterize, and differentiate an effective, an efficient, and a reliable three-dimensional model of pediatric bronchial epithelium to test the hypothesis that children with asthma differ in their epithelial morphologic phenotype when compared with nonasthmatic children. Primary cell cultures from both asthmatic and nonasthmatic children were grown and differentiated at the air-liquid interface for 28 d. Tight junction formation, MUC5AC secretion, IL-8, IL-6, prostaglandin E2 production, and the percentage of goblet and ciliated cells in culture were assessed. Well-differentiated, multilayered, columnar epithelium containing both ciliated and goblet cells from asthmatic and nonasthmatic subjects were generated. All cultures demonstrated tight junction formation at the apical surface and exhibited mucus production and secretion. Asthmatic and nonasthmatic cultures secreted similar quantities of IL-8, IL-6, and prostaglandin E2. Cultures developed from asthmatic children contained considerably more goblet cells and fewer ciliated cells compared with those from nonasthmatic children. A well-differentiated model of pediatric epithelium has been developed that will be useful for more in vivo like study of the mechanisms at play during asthma.

Suggested Binding Mechanism of the HIV-gp120 to its CD4 Receptor

The molecular recognition and attachment of the CD4 molecule and the HIV envelope glycoprotein (gp120) might be described as a consecutive three-step molecular recognition process. 1. (a) Long range interaction: electrostatic pre-orientation, 2. (b) short range interaction: electronic attachment followed by a ‘Locking-in’ (via aromatic ring orientation) and 3. (c) internal interaction (induced fit): conformational readjustment of the protein molecules. On the basis of the preliminary investigations (X-ray structures of CD4 and biological studies of CD4 and gp120 point mutants) we described a computational model. This approach consists of empirical calculations as well as ab initio level of quantum chemistry. The conformational analysis of the wild type and mutant CD4 molecules was supported by molecular mechanics and dynamics (Amber force field). The latter analysis involves the application of a novel method, the Amino Acid Conformation Assignment of Proteins (ACAP) software, developed for the notation of secondary protein structures. According to the cardinal role of the electrostatic factors during this interaction, several ab initio investigations were performed for better understanding of the recognition process on submolecular level. Using the above mentioned computational model, we could interpret the basic behaviours and predict some additional features of CD4-gp120 interaction, in spite of the missing gp120 X-ray structure.

Atomistic Insights into Rhodopsin Activation from a Dynamic Model

Rhodopsin, the light sensitive receptor responsible for blue-green vision, serves as a prototypical G protein-coupled receptor (GPCR). Upon light absorption, it undergoes a series of conformational changes that lead to the active form, metarhodopsin II (META II), initiating a signaling cascade through binding to the G protein transducin (G(t)). Here, we first develop a structural model of META II by applying experimental distance restraints to the structure of lumi-rhodopsin (LUMI), an earlier intermediate. The restraints are imposed by using a combination of biased molecular dynamics simulations and perturbations to an elastic network model. We characterize the motions of the transmembrane helices in the LUMI-to-META II transition and the rearrangement of interhelical hydrogen bonds. We then simulate rhodopsin activation in a dynamic model to study the path leading from LUMI to our META II model for wild-type rhodopsin and a series of mutants. The simulations show a strong correlation between the transition dynamics and the pharmacological phenotypes of the mutants. These results help identify the molecular mechanisms of activation in both wild type and mutant rhodopsin. While static models can provide insights into the mechanisms of ligand recognition and predict ligand affinity, a dynamic model of activation could be applicable to study the pharmacology of other GPCRs and their ligands, offering a key to predictions of basal activity and ligand efficacy.

Application of the zero-range potential model to positron annihilation on molecules

In this paper we use a zero-range potential (ZRP) method to model positron interaction with molecules. This allows us to investigate the e?ect of molecular vibrations on positron–molecule annihilation using the van der Waals dimer Kr2 as an example. We also use the ZRP to explore positron binding to polyatomics and examine the dependence of the binding energy on the size of the molecule for alkanes. We ?nd that a second bound state appears for a molecule with ten carbons, similar to recent experimental evidence for such a state emerging in alkanes with twelve carbons.

Interaction between interleukin 3 and dystrobrevin-binding protein 1 in schizophrenia

Schizophrenia is a common psychotic mental disorder that is believed to result from the effects of multiple genetic and environmental factors. In this study, we explored gene-gene interactions and main effects in both case-control (657 cases and 411 controls) and family-based (273 families, 1350 subjects) datasets of English or Irish ancestry. Fifty three markers in 8 genes were genotyped in the family sample and 44 markers in 7 genes were genotyped in the case-control sample. The Multifactor Dimensionality Reduction Pedigree Disequilibrium Test (MDR-PDT) was used to examine epistasis in the family dataset and a 3-locus model was identified (permuted p=0.003). The 3-locus model involved the IL3 (rs2069803), RGS4 (rs2661319), and DTNBP1 (rs21319539) genes. We used MDR to analyze the case-control dataset containing the same markers typed in the RGS4, IL3 and DTNBP1 genes and found evidence of a joint effect between IL3 (rs31400) and DTNBP1 (rs760761) (cross-validation consistency 4/5, balanced prediction accuracy=56.84%, p=0.019). While this is not a direct replication, the results obtained from both the family and case-control samples collectively suggest that IL3 and DTNBP1 are likely to interact and jointly contribute to increase risk for schizophrenia. We also observed a significant main effect in DTNBP1, which survived correction for multiple comparisons, and numerous nominally significant effects in several genes. (C) 2008 Elsevier B.V. All rights reserved.

Ginkgolide B and bilobalide block the pore of the 5-HT3 receptor at a location that overlaps the picrotoxin binding site

Extracts from the Ginkgo biloba tree are widely used as herbal medicines, and include bilobalide (BB) and ginkgolides A and B (GA and GB). Here we examine their effects on human 5-HT(3)A and 5-HT(3)AB receptors, and compare these to the effects of the structurally related compounds picrotin (PTN) and picrotoxinin (PXN), the two components of picrotoxin (PTX), a known channel blocker of 5-HT3, nACh and GABA(A) receptors. The compounds inhibited 5-HT-induced responses of 5-HT3 receptors expressed in Xenopus oocytes, with IC50 values of 470 mu M (BB), 730 mu M (GB), 470 mu M (PTN), 11 mu M (PXN) and > 1 mM (GA) in 5-HT(3)A receptors, and 3.1 mM (BB), 3.9 mM (GB), 2.7 mM (PTN), 62 mu M (PXN) and > 1 mM (GA) in 5-HT(3)AB receptors. Radioligand binding on receptors expressed in HEK 293 cells showed none of the compounds displaced the specific 5-HT3 receptor antagonist [H-3]granisetron, confirming that they do not act at the agonist binding site. Inhibition by GB at 5-HT(3)A receptors is weakly use-dependent, and recovery is activity dependent, indicating channel block. To further probe their site of action at 5-HT(3)A receptors, BB and GB were applied alone or in combination with PXN, and the results fitted to a mathematical model; the data revealed partially overlapping sites of action. We conclude that BB and GB block the channel of the 5-HT(3)A receptor. Thus these compounds have comparable, although less potent, behaviour than at some other Cys-loop receptors, demonstrating their actions are conserved across the family. (C) 2010 Published by Elsevier Ltd.

Receptor binding and biologic activity of synthetic ET-1 peptides in the retinal pericyte

Purpose. The purpose of this study was to examine the effect of synthetic endothelin (ET)-1 peptides with antigenic potential for binding and biologic activity using an in vitro model of microvascular pericytes.

Artemisinins act through at least two targets in a yeast model

Artemisinin and related compounds are potent and widely used antimalarial drugs but their biochemical mode of action is not clear. There is strong evidence that ATP-dependent calcium transporters are a key target in the malarial parasite. However, work using Saccharomyces cerevisiae suggests that disruption of mitochondrial function is critical in the cell killing activity of these compounds. Here it is shown that, in the absence of reducing agents, artemisinin and artesunate targeted the S. cerevisiae calcium channels Pmr1p and Pmc1p. Both compounds affected the growth of yeast on fermentable and nonfermentable media. This growth inhibition was not seen in a yeast strain in which the genes encoding both calcium channels were deleted. In the presence of reducing agents, which break the endoperoxide bridge in the drugs, growth inhibition was only observed in nonfermentable media. This inhibition could be partially relieved by the addition of a free radical scavenger. These results suggest that the drugs have two biochemical modes of action - one acting by specific binding to calcium channels and one involving free radical production in the mitochondria.

A two-tier model of polymyxin B resistance in Burkholderia cenocepacia

P>Burkholderia cenocepacia is an environmental bacterium causing serious human opportunistic infections and is extremely resistant to multiple antibiotics including antimicrobial peptides, such as polymyxin B (PmB). Extreme antibiotic resistance is attributed to outer membrane impermeability ('intrinsic' resistance). Previous work showed that production of full-length lipopolysaccharide (LPS) prevents surface binding of PmB. We hypothesized that two tiers of resistance mechanisms rendering different thresholds of PmB resistance exist in B. cenocepacia. To test this notion, candidate genes were mutated in two isogenic strains expressing full-length LPS or truncated LPS devoid of heptose ('heptoseless LPS') respectively. We uncovered various proteins required for PmB resistance only in the strain with heptoseless LPS. These proteins are not involved in preventing PmB binding to whole cells or permeabilization of the outer membrane. Our results support a two-tier model of PmB resistance in B. cenocepacia. One tier sets a very high threshold mediated by the LPS and the outer membrane permeability barrier. The second tier sets a lower threshold that may play a role in PmB resistance only when outer membrane permeability is compromised. This model may be of general applicability to understanding the high antimicrobial peptide resistance of environmental opportunistic pathogens.

FhCaBP4: A Fasciola hepatica calcium binding protein with EF-hand and dynein light chain domains

In trematodes, there is a family of proteins which combine EF-hand-containing domains with dynein light chain (DLC)-like domains. A member of this family from the liver fluke, Fasciola hepatica-FhCaBP4-has been identified and characterised biochemically. FhCaBP4 has an N-terminal domain containing two imperfect EF-hand sequences and a C-terminal dynein light chain-like domain. Molecular modelling predicted that the two domains are joined by a flexible linker. Native gel electrophoresis demonstrated that FhCaBP4 binds to calcium, manganese, barium and strontium ions, but not to magnesium or zinc ions. The hydrophobic, fluorescent probe 8-anilinonaphthalene-1-sulphonate bound more tightly to FhCaBP4 in the presence of calcium ions. This suggests that the protein undergoes a conformational change on ion binding which increases the number of non-polar residues on the surface. FhCaBP4 was protected from limited proteolysis by the calmodulin antagonist W7, but not by trifluoperazine or praziquantel. Protein-protein cross-linking experiments showed that FhCaBP4 underwent calcium ion-dependent dimerisation. Since DLCs are commonly dimeric, it is likely that FhCaBP4 dimerises through this domain. The molecular model reveals that the calcium ion-binding site is located close to a key sequence in the DLC-like domain, suggesting a plausible mechanism for calcium-dependent dimerisation.