Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Interactions of 1-Methylimidazole with UO2(CH3CO2)2 and UO2(NO3)2: Structural, Spectroscopic and Theoretical Evidence for Imidazole Binding to the Uranyl Ion

The first definitive high-resolution single-crystal X-ray structure for the coordination of the 1-methylimidazole (Meimid) ligand to UO2(Ac)2 (Ac = CH3CO2) is reported. The crystal structure evidence is confirmed by IR, Raman, and UV-vis spectroscopic data. Direct participation of the nitrogen atom of the Meimid ligand in binding to the uranium center is confirmed. Structural analysis at the DFT (B3LYP) level of theory showed a conformational difference of the Meimid ligand in the free gas-phase complex versus the solid state due to small energetic differences and crystal packing effects. Energetic analysis at the MP2 level in the gas phase supported stronger Meimid binding over H2O binding to both UO2(Ac)2 and UO2(NO3)2. In addition, self-consistent reaction field COSMO calculations were used to assess the aqueous phase energetics of combination and displacement reactions involving H2O and Meimid ligands to UO2R2 (R = Ac, NO3). For both UO2(NO3)2 and UO2(Ac)2, the displacement of H2O by Meimid was predicted to be energetically favorable, consistent with experimental results that suggest Meimid may bind uranyl at physiological pH. Also, log(Knitrate/KAc) calculations supported experimental evidence that the binding stoichiometry of the Meimid ligand is dependent upon the nature of the reactant uranyl complex. These results clearly demonstrate that imidazole binds to uranyl and suggest that binding of histidine residues to uranyl could occur under normal biological conditions.

Performance evaluation of a zerovalent iron reactive barrier: Mineralogical characteristics

There is a limited amount of information about the effects of mineral precipitates and corrosion on the lifespan and long-term performance of in situ Fe° reactive barriers. The objectives of this paper are (1) to investigate mineral precipitates through an in situ permeable Fe° reactive barrier and (2) to examine the cementation and corrosion of Fe° filings in order to estimate the lifespan of this barrier. This field scale barrier (225' long x 2' wide x 31' deep) has been installed in order to remove uranium from contaminated groundwater at the Y-12 plant site, Oak Ridge, TN. According to XRD and SEM-EDX analysis of core samples recovered from the Fe° portion of the barrier, iron oxyhydroxides were found throughout, while aragonite, siderite, and FeS occurred predominantly in the shallow portion. Additionally, aragonite and FeS were present in up-gradient deeper zone where groundwater first enters the Fe° section of the barrier. After 15 months in the barrier, most of the Fe° filings in the core samples were loose, and a little corrosion of Fe° filings was observed in most of the barrier. However, larger amounts of corrosion (~10-150 µm thick corrosion rinds) occurred on cemented iron particles where groundwater first enters the barrier. Bicarbonate/ carbonate concentrations were high in this section of the barrier. Byproducts of this corrosion, iron oxyhydroxides, were the primary binding material in the cementation. Also, aragonite acted as a binding material to a lesser extent, while amorphous FeS occurred as coatings and infilings. Thin corrosion rinds (2-50 µm thick) were also found on the uncemented individual Fe° filings in the same area of the cementation. If corrosion continues, the estimated lifespan of Fe° filings in the more corroded sections is 5 to 10 years, while the Fe° filings in the rest of the barrier perhaps would last longer than 15 years. The mineral precipitates on the Fe° filing surfaces may hinder this corrosion but they may also decrease reactive surfaces. This research shows that precipitation will vary across a single reactive barrier and that greater corrosion and subsequent cementation of the filings may occur where groundwater first enters the Fe° section of the barrier.

Formation of Novel Di-Nuclear Lanthanide Luminescent Sm(III), Eu(III) and Tb(III) Triple Stranded Helicates from a C2 Symmetrically 2,6-Dicarboxylic Amide based 1,3-Xylene Ligand in CH3CN

The synthesis of the C2-symmetrical ligand 1 consisting of two naphthalene units connected to two pyridine-2,6-dicarboxamide moieties linked by a xylene spacer and the formation of LnIII-based (Ln1/4 Sm, Eu, Tb, and Lu) dimetallic helicates [Ln2 · 13] in MeCN by means of a metal-directed synthesis is described. By analyzing the metal-induced changes in the absorption and the fluorescence of 1, the formation of the helicates, and the presence of a second species [Ln2 · 12] was confirmed by nonlinear- regression analysis. While significant changes were observed in the photophysical properties of 1, the most dramatic changes were observed in the metal-centred lanthanide emissions, upon excitation of the naphthalene antennae. From the changes in the lanthanide emission, we were able to demonstrate that these helicates were formed in high yields (ca. 90% after the addition of 0.6 equiv. of LnIII), with high binding constants, which matched well with that determined from the changes in the absorption spectra. The formation of the LuIII helicate, [ Lu2 · 13 ] , was also investigated for comparison purposes, as we were unable to obtain accurate binding constants from the changes in the fluorescence emission upon formation of [Sm2 · 13], [Eu2 · 13], and [Tb2 · 13].

Identification of Determinants of Glucose-Dependent Insulinotropic Polypeptide Receptor That Interact with N-Terminal Biologically Active Region of the Natural Ligand

Glucose-dependent insulinotropic polypeptide receptor (GIPR), a member of family B of the G-protein coupled receptors, is a potential therapeutic target for which discovery of nonpeptide ligands is highly desirable. Structure-activity relationship studies indicated that the N-terminal part of glucose-dependent insulinotropic polypeptide (GIP) is crucial for biological activity. Here, we aimed at identification of residues in the GIPR involved in functional interaction with N-terminal moiety of GIP. A homology model of the transmembrane core of GIPR was constructed, whereas a three-dimensional model of the complex formed between GIP and the N-terminal extracellular domain of GIPR was taken from the crystal structure. The latter complex was docked to the transmembrane domains of GIPR, allowing in silico identification of putative residues of the agonist binding/activation site. All mutants were expressed at the surface of human embryonic kidney 293 cells as indicated by flow cytometry and confocal microscopy analysis of fluorescent GIP binding. Mutation of residues Arg183, Arg190, Arg300, and Phe357 caused shifts of 76-, 71-, 42-, and 16-fold in the potency to induce cAMP formation, respectively. Further characterization of these mutants, including tests with alanine-substituted GIP analogs, were in agreement with interaction of Glu3 in GIP with Arg183 in GIPR. Furthermore, they strongly supported a binding mode of GIP to GIPR in which the N-terminal moiety of GIP was sited within transmembrane helices (TMH) 2, 3, 5, and 6 with biologically crucial Tyr1 interacting with Gln224 (TMH3), Arg300 (TMH5), and Phe357 (TMH6). These data represent an important step toward understanding activation of GIPR by GIP, which should facilitate the rational design of therapeutic agents.

Insights into the binding and activation sites of the receptors for cholecystokinin and gastrin

CCK receptors represent potential targets in a number of diseases. Knowledge of CCK receptor binding sites is a prerequisite for the understanding of the molecular basis for their ligand recognition, partial agonism, ligand-induced trafficking of signalling. In the current paper, we report studies from our laboratory and others which have provided new data on the molecularbasis of the pharmacology and functioning of CCK1 and CCK2 receptors. It has been shown that: 1) homologous regions of the two receptors are involved in the binding site of CCK, however, positioning of CCK slightly differs in agreement with distinct phannacophores of CCK toward the two receptors and receptor sequence variations; 2) Binding sites of most of non-peptide agonists/ antagonist are buried in the pocket formed by transmembrane helices and overlap that of CCK; Aromatic amino acids within and near the binding site, especially in helix VI, are involved in receptor activation; 4) Like for other members of family A of G-protein coupled receptors, residues of the binding sites as well as of conserved motifs such as E/DRY, NPXXY are crucial for receptor activation. (c) 2007 Elsevier B.V. All rights reserved.

Discovery of substituted maleimides as liver X receptor agonists and determination of a ligand-bound crystal structure

Substituted 3-(phenylamino)-1H-pyrrole-2,5-diones were identified from a high throughput screen as inducers of human ATP binding cassette transporter A1 expression. Mechanism of action studies led to the identification of GSK3987 (4) as an LXR ligand. 4 recruits the steroid receptor coactivator-1 to human LXR alpha and LXRP with EC(50)s of 40 nM, profiles as an LXR agonist in functional assays, and activates LXR though a mechanism that is similar to first generation LXR agonists.

Novel biomarkers in early diagnosis of acute myocardial infarction compared with cardiac troponin T

Aims: To evaluate the role of novel biomarkers in early detection of acute myocardial infarction (MI) in patients admitted with acute chest pain.
Methods and results: A prospective study of 664 patients presenting to two coronary care units with chest pain was conducted over 3 years from 2003. Patients were assessed on admission: clinical characteristics, ECG (electrocardiogram), renal function, cardiac troponin T (cTnT), heart fatty acid binding protein (H-FABP), glycogen phosphorylase-BB, NT-pro-brain natriuretic peptide, D-dimer, hsCRP (high sensitivity C-reactive protein), myeloperoxidase, matrix metalloproteinase-9, pregnancy associated plasma protein-A, soluble CD40 ligand. A =12 h cTnT sample was also obtained. MI was defined as cTnT = 0.03 µg/L. In patients presenting <4 h of symptom onset, sensitivity of H-FABP for MI was significantly higher than admission cTnT (73 vs. 55%; P = 0.043). Specificity of H-FABP was 71%. None of the other biomarkers challenged cTnT. Combined use of H-FABP and cTnT (either one elevated initially) significantly improved the sensitivities of H-FABP or cTnT (85%; P = 0.004). This combined approach also improved the negative predictive value, negative likelihood ratio, and the risk ratio.
Conclusion: Assessment of H-FABP within the first 4 h of symptoms is superior to cTnT for detection of MI, and is a useful additional biomarker for patients with acute chest pain.

Comparison of Dynamics of Extracellular Accesses to the β(1) and β(2) Adrenoceptors Binding Sites Uncovers the Potential of Kinetic Basis of Antagonist Selectivity.

From the molecular mechanism of antagonist unbinding in the ß(1) and ß(2) adrenoceptors investigated by steered molecular dynamics, we attempt to provide further possibilities of ligand subtype and subspecies selectivity. We have simulated unbinding of ß(1) -selective Esmolol and ß(2) -selective ICI-118551 from both receptors to the extracellular environment and found distinct molecular features of unbinding. By calculating work profiles, we show different preference in antagonist unbinding pathways between the receptors, in particular, perpendicular to the membrane pathway is favourable in the ß(1) adrenoceptor, whereas the lateral pathway involving helices 5, 6 and 7 is preferable in the ß(2) adrenoceptor. The estimated free energy change of unbinding based on the preferable pathway correlates with the experimental ligand selectivity. We then show that the non-conserved K347 (6.58) appears to facilitate in guiding Esmolol to the extracellular surface via hydrogen bonds in the ß(1) adrenoceptor. In contrast, hydrophobic and aromatic interactions dominate in driving ICI-118551 through the easiest pathway in the ß(2) adrenoceptor. We show how our study can stimulate design of selective antagonists and discuss other possible molecular reasons of ligand selectivity, involving sequential binding of agonists and glycosylation of the receptor extracellular surface. © 2012 John Wiley & Sons A/S.

Binding site of AMPA-receptor allosteric modulator

The computer molecular docking of piperonyl acid piperidide (BDP) and some its analogs already known as ampakins was conducted for estimating their possible binding with AMPA-receptor glutamate domains in cyclothiazide binding area and for further design of new structures maximally complimentary to the receptor. On the base of the conducted docking it can be suggested that the binding site of BDP (amides of benzodioxane-6-carboxylic and piperonyl acids) analogs is located in AMPA-receptor cyclothiazide binding pocket. It is shown that formation of protein-ligand complexes of AMPA-receptor with benzodioxane-6-carboxylic and piperonyl acid derivatives, similarly to cyclothiazide, proceeds with interaction with Ser497, Leu751, which significance is confirmed by site-specific mutagenesis.

Extracellular ionic locks determine variation in constitutive activity and ligand potency between species orthologs of the free fatty acid receptors FFA2 and FFA3

Free fatty acid receptors 2 and 3 (FFA2 and FFA3) are G protein-coupled receptors for short chain free fatty acids (SCFAs). They respond to the same set of endogenous ligands but with distinct rank-order of potency, such that acetate (C2) has been described as FFA2 selective while propionate (C3) is non-selective. Although C2 was confirmed to be selective for human FFA2 over FFA3, this ligand was not selective between the mouse orthologs. Moreover, although C3 was indeed not selective between the human orthologs it displayed clear selectivity for mouse FFA3 over mouse FFA2. This altered selectivity to C2 and C3 resulted from broad differences in SCFAs potency at the mouse orthologs. In studies to define the molecular basis for these observations marked variation in ligand-independent, constitutive activity was identified. The orthologs with higher potency for the SCFAs, human FFA2 and mouse FFA3, displayed high constitutive activity while the orthologs with lower potency for the agonist ligands, mouse FFA2 and human FFA3, did not. Sequence alignments of the 2nd extracellular loop identified single negatively charged residues in FFA2 and FFA3 not conserved between species and predicted to form ionic lock interactions with arginine residues within the FFA2 or FFA3 agonist binding pocket to regulate constitutive activity and SCFA potency. Reciprocal mutation of these residues between species orthologs resulted in the induction (or repression) of constitutive activity, and in most cases also yielded corresponding changes in SCFA potency.

Complement factor H is a serum-binding protein for adrenomedullin, and the resulting complex modulates the bioactivities of both partners

Adrenomedullin (AM) is an important regulatory peptide involved in both physiological and pathological states. We have previously demonstrated the existence of a specific AM-binding protein (AMBP-1) in human plasma. In the present study, we developed a nonradioactive ligand blotting assay, which, together with high pressure liquid chromatography/SDS-polyacrylamide gel electrophoresis purification techniques, allowed us to isolate AMBP-1 to homogeneity. The purified protein was identified as human complement factor H. We show that AM/factor H interaction interferes with the established methodology for quantification of circulating AM. Our data suggest that this routine procedure does not take into account the AM bound to its binding protein. In addition, we show that factor H affects AM in vitro functions. It enhances AM-mediated induction of cAMP in fibroblasts, augments the AM-mediated growth of a cancer cell line, and suppresses the bactericidal capability of AM on Escherichia coli. Reciprocally, AM influences the complement regulatory function of factor H by enhancing the cleavage of C3b via factor I. In summary, we report on a potentially new regulatory mechanism of AM biology, the influence of factor H on radioimmunoassay quantification of AM, and the possible involvement of AM as a regulator of the complement cascade.

Mutations within subdomain II of the extracellular region of epidermal growth factor receptor selectively alter TGF alpha binding

The interactions of epidermal growth factor (EGF) and transforming growth factor alpha (TGF alpha) with the epidermal growth factor receptor (EGFR) were examined by insertion mutagenesis of the receptor. Seventeen insertions were made throughout a construct containing only the extracellular domain. This truncated receptor (sEGFR) was secreted and had a dissociation constant similar to that of the full-length solubilized receptor. Receptors with insertions within subdomain III were not secreted. Two receptors with insertions at positions 291 and 474, which border subdomain III, have significantly decreased binding to both EGF and TGF alpha relative to wild type. This confirms previous work demonstrating that subdomain III forms the primary binding site for EGF and TGF alpha. Four of the mutants within subdomain II had a decreased binding to TGF alpha relative to wild type, but had wild type binding to EGF. These results suggest that a region within subdomain II may selectively regulate the binding of TGF alpha. Two receptors which contained insertions within subdomains II and IV, approximately equidistant from the center of subdomain III, bound twofold more ligand molecules than wild type receptor, with an affinity similar to that of wild type receptor. These findings suggest that insertion at these positions allows the access of more than one ligand molecule to the binding site.

Evaluation of the Factors Contributing to Levonorgestrel Binding in Addition Cure Silicone Elastomer Vaginal Rings

Background: Following progress of the dapivirine (DPV)-releasing silicone elastomer (SE) vaginal ring (VR) into Phase III clinical studies, there is now interest in developing next-generation rings that additionally provide contraception. Levonorgestrel (LNG) is a safe and effective progestin that is being widely considered for use as a hormonal contraceptive agent in future multipurpose prevention technology (MPT) products. Although LNG has previously been incorporated into various controlled release SE devices, minimal attention has focused on its propensity to irreversibly react with addition cure SE systems. Here, for the first time, we investigate this LNG binding phenomenon and outline strategies for overcoming it.
Methods: VRs containing various loadings of DPV and LNG were manufactured and in vitro release assessed. Different LNG-only SE samples were also prepared to assess the following parameters: (i) addition cure vs. condensation cure SEs; (ii) different types of addition cure SEs; (iii) mixing time, (iv) cure temperature, (v) cure time; and (vi) LNG particle size. After manufacture, the LNG-only samples were assayed for total drug content using a solvent extraction method. The SE curing reaction and the LNG binding reaction was probed using nuclear magnetic resonance (NMR) spectroscopy. Results:
Under certain drug/formulation/processing conditions, LNG was not recoverable from VRs. Further studies using non-ring samples showed that: (a) the phenomenon was only observed with addition cure SEs (and not condensation cure SEs); (b) the extent of binding was dependent upon the type of addition cure SE; (c) micronised LNG showed significantly greater binding than non-micronised LNG; (d) the extent of binding correlated with increased mixing time, cure time and cure temperature.
Conclusions: Careful control of the API characteristics, the SE composition, and the manufacturing conditions will be necessary to establish a practical VR formulation for controlled release of LNG.