380 resultados para Bartz, Nicholas
Resumo:
The enantiomerically pure ligands LRR and LSS (N,N'-bis(-2,2'-bipyridyl-5-yl)carbonyl-(1S/R,2S/R)-(+/-)-1,2-diaminocyclohexane) have been synthesised by linking two 2,2'-bipyridine units by (R,R)- and (S,S)-1,2-diaminocyclohexane respectively. The crystal structure confirmed that the ligand had a twisted orientation between the two chelating units. The reaction of LRR and LSS with Fe(II), Co(III), Cd(II) and Zn(II) afforded dinuclear complexes confirmed by ES mass spectroscopy. CD spectroscopy indicated that the chiral diaminocyclohexane conferred helicity to the metal centre giving a dominant triple helicate diastereoisomer, with the LRR ligand giving a delta-configuration of each metal centre (P helicate) and the LSS ligand a lambda configuration (M helicate). 1H NMR spectroscopy confirmed a dominant major diastereoisomer with cadmium. The Zn(II) and Cd(II) complexes however were observed to undergo rapid ligand dissociation in solution.
Resumo:
Fac-ruthenium(II) tris-(5-carboxy-2,2'-bipyridine) has been synthesised as a single geometric isomer for the first time, and proves to be a good "building-block" to introduce new functionality with retention of the isomeric integrity.
Resumo:
Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.
Resumo:
Bacterial infection primarily with Staphylococcus spp. and Propionibacterium acnes remains a significant complication following total hip replacement. In this in vitro study, we investigated the efficacy of gentamicin loading of bone cement and pre- and postoperative administration of cefuroxime in the prevention of biofilm formation by clinical isolates. High and low initial inocula, representative of the number of bacteria that may be present at the operative site as a result of overt infection and skin contamination, respectively, were used. When a high initial inoculum was used, gentamicin loading of the cement did not prevent biofilm formation by the 10 Staphylococcus spp. and the 10 P. acnes isolates tested. Similarly, the use of cefuroxime in the fluid phase with gentamicin-loaded cement did not prevent biofilm formation by four Staphylococcus spp. and four P. acnes isolates tested. However, when a low bacterial inoculum was used, a combination of both gentamicin-loaded cement and cefuroxime prevented biofilm formation by these eight isolates. Our results indicate that this antibiotic combination may protect against infection after intra-operative challenge with bacteria present in low numbers as a result of contamination from the skin but would not protect against bacteria present in high numbers as a result of overt infection of an existing implant.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.