The isolation and purification of tris-2,2'-bipyridine complexes of ruthenium(II) containing unsymmetrical ligands

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Antisense Bcl-2 Oligonucleotide Uptake in Human Transitional Cell Carcinoma.

Objectives; Antisense oligonucleotides (AO) downregulate Bcl-2 protein expression in various tumours if good target cell uptake is achieved. In this study, uptake of FITC labelled AO (FITC-AO) directed at Bcl-2 was examined in; (1) the RT4 bladder tumour cell line (2) normal pig urothelium and (3) human superficial bladder tumours. Methods; In the RT4 cell line, uptake of FITC-AO, FITC-scrambled and FITC-sense oligonucleotides were quantified by flow cytometry at 4h intervals over 24h. Uptake of FITC-AO was assessed in normal pig urothelium by flow cytometry after FITC-AO was infused for 1h. Uptake of FITC AO was assessed in samples from 14 human superficial bladder tumours which were maintained in an ex vivo model. In samples from 6 tumours, uptake at 4h was assessed using fluorescence microscopy. In samples from 8 separate tumours uptake every 4h within the first 24h incubation period was assessed by flow cytometry. Results; In the RT4 cell line the FITC-AO, FITC-scrambled and FITC-sense oligonucleotide uptake was similar. Disaggregated cells from the normal urothelium of the three pigs exhibited 33%, 46%, 51% of cells staining positively for FITC-AO as determined by flow cytometry. All 6 tumour samples had detectable intracellular FITC-AO by fluorescence microscopy at 4h. In the 8 tumours ,examined over the 24h incubation period, there was a range of percentages of positively staining cells. However, most tumours had a monotonic increase in intracellular fluorescence intensity that plateaued 16h post infusion. Conclusion; Antisense Bcl-2 oligonucleotides were readily taken up by superficial bladder cancer cells but the heterogenous uptake in tumour samples needs to be considered when assessing the bioavailability of these drugs.

Resonance Raman and lifetime studies on regioselectively deuteriated ruthenium (II) polypyridyl complexes

Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.

Electrical activity induced by nitric oxide in canine colonic circular muscle.

Nitric oxide generates slow electrical oscillations (SEOs) in cells near the myenteric edge of the circular muscle layer, which resemble slow waves generated by interstitial cells of Cajal (ICCs) at the submucosal edge of this muscle. The properties of SEOs were studied to determine whether these events are similar to slow waves. Rapid frequency membrane potential oscillations (MPOs; 16 +/- 1 cycles/min and 9.6 +/- 0.2 mV) were recorded from control muscles near the myenteric edge. Sodium nitroprusside (0.3 microM) reduced MPOs and initiated SEOs (1.3 +/- 0.3 cycles/min and 13.4 +/- 1.4 mV amplitude). SEOs were abolished by the guanylate cyclase inhibitor 1H-[1,2,4]-oxadiazolo-[4,3-a]-quinoxaline-1-one (10 microM). MPOs were abolished by nifedipine (1 microM), whereas SEO frequency increased and the amount of depolarization decreased. BAY K 8644 (1 microM) prolonged SEOs and reduced their frequency. SEOs were abolished by Ni(2+) (0.5 mM), low Ca(2+) solution (0.1 mM Ca(2+)), cyclopiazonic acid (10 microM), and the mitochondrial uncouplers antimycin (10 microM) and carbonyl cyanide p-trifluoromethoxyphenylhydrazone (1 microM). Oligomycin (10 microM) was without effect. These effects are similar to those described for colonic slow waves. Our results suggest that nitric oxide-induced SEOs are similar in mechanism to slow waves, an activity not previously thought to be generated by myenteric pacemakers.

Potential and kinetic sputtering of alkanethiol self-assembled monolayers by impact of highly charged ions

Highly charged ions have been used to study the sputtering of positive molecular fragments from mercaptoundecanoic acid and dodecanethiol self-assembled monolayers on gold surfaces. The samples were bombarded with Arq+ (42n⁺, and Cn+1O2H_{2n + 1}⁺ from mercaptoundecanoic and H+, CnH_2n⁺, and Cn+1H_{2n + 3}⁺ from dodecanethiol. The proton yields were increased with larger charge state q of the highly charged ion (HCI) in both samples, scaling as qgamma, with gamma~5. The charge state dependence is discussed in terms of electron transfer to the HCI. The final yield of protons depends on molecular functional group characteristics, orientation on the surface, and reneutralization phenomena.

Partial agonism, neutral antagonism, and inverse agonism at the human wild-type and constitutively active cholecystokinin-2 receptors

Cholecystokinin receptor-2 (CCK2R) is a G protein receptor that regulates a number of physiological functions. Activation of CCK2R and/or expression of a constitutively active CCK2R variant may contribute to human diseases, including digestive cancers. Search for antagonists of the CCK2R has been an important challenge during the last few years, leading to discovery of a set of chemically distinct compounds. However, several early-discovered antagonists turned out to be partial agonists. In this context, we carried out pharmacological characterization of six CCK2R antagonists using COS-7 cells expressing the human CCK2R or a CCK2R mutant having a robust constitutive activity on inositol phosphates production, and we investigated the molecular mechanisms which, at a CCK2R binding site, account for these features. Results indicated that three compounds, 3R(+)-N-(2,3-dihydro-1-methyl-2-oxo-5-phenyl-1H-1,4-benzodiazepin-3- yl)-N'-(3-methylphenyl)urea (L365,260), 4-{[2-[[3-(lH-indol-3-yl)-2- methyl-1-oxo-2-[[[1.7.7-trimethyl-bicyclo[2.2.1]hept-2-yl)-oxy]carbonyl]amino] propyl]amino]-1-phenylethyl]amino-4-oxo-[lS-la.2[S*(S*)]4a]} -butanoate N-methyl-D-glucamine (PD135, 158), and (R)-1-naphthalenepropanoic acid, b-[2-[[2-(8-azaspiro-[4.5]dec-8-ylcarbonyl)-4,6-dimethylphenyl]amino]-2- oxoethyl] (CR2945), were partial agonists; one molecule, 1-[(R)-2,3-dihydro-1- (2,3-dihydro-1-(2-methylphenacyl)-2-oxo-5-phenyl-1H-1,4-benzodiazepin-3-yl] -3-(3-methylphenyl)urea (YM022), was a neutral antagonist; and two compounds, N-(+)-[1-(adamant-1-ylmethyl)-2,4-dioxo-5-phenyl2,3,4,5-tetrahydro-1H-1, 5-benzodiazepin-3-yl]-N'-phenylurea (GV150,013X) and ([(N-[methoxy-3 phenyl] N-[N-methyl N-phenyl carbamoylmethyl], carbomoylmethyl)-3 ureido]-3-phenyl)2-propionic acid (RPR101,048), were inverse agonists. Furthermore, target- and pharmacophore-based docking of ligands followed by molecular dynamic simulation experiments resulted in consistent motion of aromatic residues belonging to a network presumably important for activation, thus providing the first structural explanations for the different pharmacological profiles of tested compounds. This study confirms that several referenced so-called antagonists are in fact partial agonists, and because of this undesired activity, we suggest that newly generated molecules should be preferred to efficiently block CCK2R-related physiological effects. Furthermore, data on the structural basis for the different pharmacological features of CCK2R ligands will serve to further clarify CCK2R mechanism of activation. Copyright © 2006 The American Society for Pharmacology and Experimental Therapeutics.

Discovery of substituted maleimides as liver X receptor agonists and determination of a ligand-bound crystal structure

Substituted 3-(phenylamino)-1H-pyrrole-2,5-diones were identified from a high throughput screen as inducers of human ATP binding cassette transporter A1 expression. Mechanism of action studies led to the identification of GSK3987 (4) as an LXR ligand. 4 recruits the steroid receptor coactivator-1 to human LXR alpha and LXRP with EC(50)s of 40 nM, profiles as an LXR agonist in functional assays, and activates LXR though a mechanism that is similar to first generation LXR agonists.

Vasodilator-Stimulated Phosphoprotein Regulates Inside-Out Signaling of beta(2) Integrins in Neutrophils

The monomeric GTPase Rap1 controls functional activation of beta2 integrins in leukocytes. In this article, we describe a novel mechanism by which the chemoattractant fMLP activates Rap1 and inside-out signaling of beta2 integrins. We found that fMLP-induced activation of Rap1 in human polymorphonuclear leukocytes or neutrophils and differentiated PLB-985 cells was blocked by inhibitors of the NO/guanosine-3',5'-cyclic monophosphate-dependent protein kinase (cGKI) pathway [N-(3-(aminomethyl)benzyl)acetamidine, 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one, DT-3 peptide, 8-(4-chlorophenylthio)guanosine 3',5'-cyclic monophosphothioate, Rp-isomer triethylammonium salt-guanosine-3',5'-cyclic monophosphate], indicating that the downstream signaling events in Rap1 activation involve the production of NO and guanosine-3',5'-cyclic monophosphate, as well as the activation of cGKI. Silencing the expression of vasodilator-stimulated phosphoprotein (VASP), a substrate of cGKI, in resting PLB-985 cells or mice neutrophils led to constitutive activation of Rap1. In parallel, silencing VASP in differentiated PLB-985 cells led to recruitment of C3G, a guanine nucleotide exchange factor for Rap1, to the plasma membrane. Expression of murine GFP-tagged phosphodeficient VASP Ser235Ala mutant (murine serine 235 of VASP corresponds to human serine 239) in PLB-985 cells blunted fMLP-induced translocation of C3G to the membrane and activation of Rap1. Thus, bacterial fMLP triggers cGKI-dependent phosphorylation of human VASP on serine 239 and, thereby, controls membrane recruitment of C3G, which is required for activation of Rap1 and beta2 integrin-dependent antibacterial functions of neutrophils.

The role of infrequent and extraordinary deep dives in leatherback turtles (Dermochelys coriacea)

Infrequent and exceptional behaviours can provide insight into the ecology and physiology of a particular species. Here we examined extraordinarily deep (300-1250 m) and protracted (>1h) dives made by critically endangered leatherback turtles (Dermochelys coriacea) in the context of three previously suggested hypotheses: predator evasion, thermoregulation and exploration for gelatinous prey. Data were obtained via satellite relay data loggers attached to adult turtles at nesting beaches (N=11) and temperate foraging grounds (N=2), constituting a combined tracking period of 9.6 years (N=26,146 dives) and spanning the entire North Atlantic Ocean. Of the dives, 99.6% (N=26,051) were to depths <300 m with only 0.4% (N=95) extending to greater depths (subsequently termed 'deep dives'). Analysis suggested that deep dives: (1) were normally distributed around midday; (2) may exceed the inferred aerobic dive limit for the species; (3) displayed slow vertical descent rates and protracted durations; (4) were much deeper than the thermocline; and (5) occurred predominantly during transit, yet ceased once seasonal residence on foraging grounds began. These findings support the hypothesis that deep dives are periodically employed to survey the water column for diurnally descending gelatinous prey. If a suitable patch is encountered then the turtle may cease transit and remain within that area, waiting for prey to approach the surface at night. If unsuccessful, then migration may continue until a more suitable site is encountered. Additional studies using a meta-analytical approach are nonetheless recommended to further resolve this matter.

An introduction to biological nuclear magnetic resonance spectroscopy

ABSTRACT Nuclear magnetic resonance (NMR) spectroscopy is one of the most powerful analytical techniques available to biology. This review is an introduction to the potential of this method and is aimed at readers who have little or no experience in acquiring or analyzing NMR spectra. We focus on spectroscopic applications of the magnetic resonance effect, rather than imaging ones, and explain how various aspects of the NMR phenomenon make it a versatile tool with which to address a number of biological problems. Using detailed examples, we discuss the use of 1H NMR spectroscopy in mixture analysis and metabolomics, the use of 13C NMR spectroscopy in tracking isotopomers and determining the flux through metabolic pathways (‘fluxomics’) and the use of 31P NMR spectroscopy in monitoring ATP generation and intracellular pH homeotasis in vivo. Further examples demonstrate how NMR spectroscopy can be used to probe the physical environment of a cell by measuring diffusion and the tumbling rates of individual metabolites and how it can determine macromolecular structures by measuring the bonds and distances which separate individual atoms. We finish by outlining some of the key challenges which remain in NMR spectroscopy and we highlight how recent advances— such as increased magnet field strengths, cryogenic cooling, microprobes and hyperpolarisation—are opening new avenues for today’s biological NMR spectroscopists.

An Investigation into the Dissolution Properties of Celecoxib Melt Extrudates: Understanding the Role of Polymer Type and Concentration in Stabilizing Supersaturated Drug Concentrations

In this study, the dissolution properties of celecoxib (CX) solid dispersions manufactured from Eudragit 4155F and polyvinylpyrrolidone (PVP) were evaluated. Hot-melt extrusion (HME) technology was used to prepare amorphous solid dispersions of drug/polymer binary systems at different mass ratios. The drug concentrations achieved from the dissolution of PVP and Eudragit 4155F solid dispersions in phosphate buffer, pH 7.4 (PBS 7.4) were significantly greater than the equilibrium solubility of CX (1.58 µg/mL). The degree of supersaturation increased significantly as the polymer concentration within the solid dispersion increased. The maximum drug concentration achieved by PVP solid dispersions did not significantly exceed the apparent solubility of amorphous CX. The predominant mechanism for achieving supersaturated CX concentrations in PBS 7.4 was attributed to stabilization of amorphous CX during dissolution. Conversely, Eudragit 4155F solid dispersions showed significantly greater supersaturated drug solutions particularly at high polymer concentrations. For example, at a drug/polymer ratio of 1:9, a concentration of 100 µg/mL was achieved after 60 min that was stable (no evidence of drug recrystallization) for up to 72 h. This clearly identifies the potential of Eudragit 4155F to act as a solubilizing agent for CX. These findings were in good agreement with the results from solubility performed using PBS 7.4 in which Eudragit 4155F had been predissolved. In these tests, Eudragit 4155F significantly increased the equilibrium solubility of CX. Solution 1H NMR spectra were used to identify drug/polymer interactions. Deshielding of CX aromatic protons (H-1a and H-1b) containing the sulfonamide group occurred as a result of dissolution of Eudragit 4155F solid dispersions, whereas deshielding of H-1a protons and shielding of H-1b protons occurred as a result of the dissolution of PVP solid dispersions. In principle, it is reasonable to suggest that the different drug/polymer interactions observed give rise to the variation in dissolution observed for the two polymer/drug systems.

Use of NMR metabolomic plasma profiling methodologies to identify illicit growth-promoting administrations

Detection of growth-promoter use in animal production systems still proves to be an analytical challenge despite years of activity in the field. This study reports on the capability of NMR metabolomic profiling techniques to discriminate between plasma samples obtained from cattle treated with different groups of growth-promoting hormones (dexamethasone, prednisolone, oestradiol) based on recorded metabolite profiles. Two methods of NMR analysis were investigated—a Carr–Purcell–Meiboom–Gill (CPMG)-pulse sequence technique and a conventional 1H NMR method using pre-extracted plasma. Using the CPMG method, 17 distinct metabolites could be identified from the spectra. 1H NMR analysis of extracted plasma facilitated identification of 23 metabolites—six more than the alternative method and all within the aromatic region. Multivariate statistical analysis of acquired data from both forms of NMR analysis separated the plasma metabolite profiles into distinct sample cluster sets representative of the different animal study groups. Samples from both sets of corticosteroid-treated animals—dexamethasone and prednisolone—were found to be clustered relatively closely and had similar alterations to identified metabolite panels. Distinctive metabolite profiles, different from those observed within plasma from corticosteroid-treated animal plasma, were observed in oestradiol-treated animals and samples from these animals formed a cluster spatially isolated from control animal plasma samples. These findings suggest the potential use of NMR methodologies of plasma metabolite analysis as a high-throughput screening technique to aid detection of growth promoter use.

Ruthenium Cryptates with an Unusual Selectivity for Nitrate

The synthesis of two new tripodal complexes [Ru(L3)](PF6)2 and [Ru(L4)](PF6)2, encapsulating a ruthenium(II) cation has been successfully achieved and the products fully characterized, including by X-ray structural determination. The smaller cavity, built around a tris(2-aminoethyl)amido scaffold demonstrated only moderate and predictable interactions with a range of anions and no significant spectroscopic change with nitrate, chloride and bromide, although dihydrogen phosphate did result in an almost stoichiometric precipitation. The expansion of the cavity to include the more rigid 1,3,5-benzenetricarbonylamide group creates a larger cavity, which shows a decrease in the emission on the introduction of chloride, bromide, hydrogensulfate and nitrate salts, with the 1H NMR titrations giving a surprisingly high binding affinity for nitrate over the smaller and simpler halides.

Comments and Additional Work on “High-Pressure Volumetric Properties of Imidazolium-Based Ionic Liquids: Effect of the Anion”

This works follows a publication of our group in J. Chem. Eng. Data2007, 52, 2204–2211 presenting high temperature and pressure density data for five imidazolium-based ionic liquids. At this period, very few ionic liquid density data were available in the literature, especially at high pressure, and the uncertainty of published results was calculated with respect to the literature data available for three of the five ionic liquids studied. Since 2007, the ionic liquid density databank has largely increased. In this work, a comparison of our published data in J. Chem. Eng. Data2007, 52, 2204–2211, with more than 1800 high pressure data coming from the literature up to December 2011 is presented to assess the uncertainty of our published values. The claimed uncertainty is close to 0.31 % for all IL density data sets except in the case of the [C1C2Im][EtSO4], where the uncertainty is up to 1.1 %. Reported data in J. Chem. Eng. Data2007, 52, 2204–2211, for this particular ionic liquid cannot be used as a reference. For this ionic liquid, new density measurements of the same sample batch have been remeasured by using the same experimental technique, and new experimental data presented herein are clearly higher than our previous published results. A 1H NMR analysis of the sample has confirmed hydrolysis of the ethylsulfate anion to ethanol and hydrogenate anion which explains the differences observed between our density data and the literature.