The isolation and purification of tris-2,2'-bipyridine complexes of ruthenium(II) containing unsymmetrical ligands

Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Resonance Raman and lifetime studies on regioselectively deuteriated ruthenium (II) polypyridyl complexes

Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.

Ruthenium complexes of the 1,4-bis(diphenylphosphino)-1,3-butadiene-bridged diphosphine 1,2,3,4-Me-4-NUPHOS: Solvent-dependent interconversion of four- and six-electron donor coordination and transfer hydrogenation activity

In chloroform, [RuCl2(nbd)(py)(2)] (1) (nbd = norbornadiene; py = pyridine) reacts with 1,4-bis(diphenylphosphino)-1,2,3,4-tetramethyl-1,3-butadiene (1,2,3,4-Me-4-NUPHOS) to give the dimer [Ru2Cl3(eta(4)-1,2,3,4-Me-4-NUPHOS)(2)]Cl (2a), whereas, in THF [RuCl2(1,2,3,4-Me-4-NUPHOS)(PY)(2)] (3) is isolated as the sole product of reaction. Compound 2 exists as a 4:1 mixture of two noninterconverting isomers, the major with C, symmetry and the minor with either C, or C-2 symmetry. A single-crystal X-ray analysis of [Ru2Cl3 (eta(4)-1,2,3,4-Me-4-NUPHOS)(2)] [SbF6] (2b), the hexafluoroantimonate salt of 2a, revealed that the diphosphine coordinates in an unusual manner, as a eta(4)-six-electron donor, bonded through both P atoms and one of the double bonds of the butadiene tether. Compounds 2a and 3 react with 1,2-ethylenediamine (en) in THF to afford [RuCl2(1,2,3,4-Me-4-NUPHOS)(en)] (4), which rapidly dissociates a chloride ligand in chloroform to give [RuCl(eta(4)-1,2,3,4-Me-4-NUPHOS)(en)] [Cl] (5a). Complexes 4 and 5a cleanly and quantitatively interconvert in a solvent-dependent equilibrium, and in THF 5a readily adds chloride to displace the eta(2)-interaction and re-form 4. A single-crystal X-ray structure determination of [RuCl(eta(4)-1,2,3,4-Me-4-NUPHOS)(en)][ClO4] (5b) confirmed that the diphosphine coordinates in an eta(4)-manner as a facial six-electron donor with the eta(2)-coordinated double bond occupying the site trans to chloride. The eta(4)-bonding mode can be readily identified by the unusually high-field chemical shift associated with the phosphorus atom adjacent to the eta(2)-coordinated double bond. Complexes 2a, 2b, 4, and 5a form catalysts that are active for transfer hydrogenation of a range of ketones. In all cases, catalysts formed from precursors 2a and 2b are markedly more active than those formed from 4 and 5a.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.

Benzothiazole bipyridine complexes of ruthenium(II) with cytotoxic activity

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

The isolation and secondary functionalisation of the mer- and fac-isomers of tris(5-hydroxymethyl-2,2 '-bipyridine) complexes of ruthenium(II)

Tris-chelate 5-hydroxymethyl-2,2 '-bipyridine complexes of ruthenium (II) and the structurally related benzo- and naphthoesters have been isolated. The mer-isomer of the alcohol functionalised complex has been isolated by selective precipitation from methylene chloride and was subsequently functionalised to the benzoester with retention of the geometrical isomerism. The fac- and merisomeric forms of the ester complexes were separated using preparative plate silica chromatography and characterised by H-1 NMR spectroscopy. X-ray structural analysis of the fac-isomer of both the ester complexes confirmed the product assignment. The photophysical properties of the three isomers were investigated, indicating very similar absorption spectra to [Ru(biPY)(3)](2+). The emission wavelength was comparable in each case, with the aromatic ester complexes giving a much longer lifetime and higher quantum yields. (c) 2004 Elsevier B.V. All rights reserved.

The comparison of fac and mer ruthenium(II) trischelate complexes in anion binding

The synthesis of three new homoleptic trischelate ruthenium( II) complexes bearing new 2,2'-bipyridine ligands, 5,5'-dibenzylamido-2,2'-bipyridine (L1) and 5-benzylamido-2,2'- bipyridine (L2) has been achieved. In the case of [Ru(L2)(3)](2+), the mer and fac isomers have been separated. H-1 NMR spectroscopic anion binding studies indicate that the two C-3-symmetric pockets provided by [ Ru(L1)(3)](2+) is conducive to receive a range of anions, although this is not readily reflected in the photophysical behaviour. The fac-isomer of [Ru(L2)(3)](2+) does appear to have an enhancement in the binding interactions over the mer form with dihydrogenphosphate salts, although the difference is much less marked with the spherical chloride ions. From X-ray crystallographic evidence, the ability to hold water in the "anion" binding cleft can inhibit the strength of the interactions with anions, giving rise to the observed selectivity for directional oxoanions such as dihydrogen phosphate.

Chromium, iron, ruthenium and gold complexes of 3,3-(biphenyl-2,2 '-diyl)-1-diphenylphosphino-1-phenylallene: A versatile ligand

Successive treatment of 9-(phenylethynyl)fluoren-9-ol (1a), with HBr, butyllithium and chlorodiphenylphosphine furnishes 3,3-(biphenyl-2,2'-diyl)-1-diphenylphosphino-1-phenylallene (5). Moreover, reaction of 1a directly with chlorodiphenylphosphine yields the corresponding allenylphosphine oxide (6). The allenylphosphine (5), and Fe-2(CO)(9) initially form the phosphine-Fe(CO)(4) complex, 11, which is very thermally sensitive and readily loses a carbonyl ligand. In the resulting phosphine-Fe(CO)(3) system, 12, the additional site at iron is coordinated by the allene double bond adjacent to phosphorus; the Fe(CO) 3 tripod in 12 exhibits restricted rotation on the NMR time-scale even at room temperature. The corresponding chromium complex, (5)-Cr(CO)5 (9), has also been prepared. The gold complexes (5)AuCl (13), and [(5)-Au(THT)](+) X-, where (THT) is tetrahydrothiophene, and X = PF6 (14a), or ClO4 (14b), are analogous to the known triphenylphosphine-gold complexes. In contrast, in the (arene)(allenylphosphine) RuCl2 system the allene double bond adjacent to phosphorus displaces a chloride, and the resulting cationic species undergoes nucleophilic attack by water yielding ultimately a five-membered Ru-P-C=C-O ruthenacycle (17). Thus, the allenylphosphine (5), reacts initially as a conventional mono-phosphine but, when the metal centre has a readily displaceable ligand such as a carbonyl or halide, the allene double bond adjacent to the phosphorus can also function as a donor. X- ray crystal structures are reported for 5, 6, 11, 12, 13, 14a, 14b and 17.

Rare-earth complexes of ferrocene-containing ligands: Visible-light excitable luminescent materials

The ferrocene-derivatives bis(ferrocenyl-ethynyl)-1,10-phenanthroline (Fc(2)phen) and ferrocenoyltrifluoroacetone (Hfta) have been used to synthesize ferrocene-containing rare-earth beta-diketonate complexes. The complexes [Ln(tta)(3)(Fc(2)phen)] and [Ln(fta)(3)(phen)] (where Ln = La, Nd, Eu, Yb) show structural similarities to the tris(2-thenoyltrifluoroacetonate)(1,10-phenanthroline)lanthanide(III) complexes, [Ln(tta)(3)(phen)]. The coordination number of the lanthanide ion is 8, and the coordination sphere can be described as a distorted dodecahedron. However, the presence of the ferrocene moieties shifts the ligand absorption bands of the rare-earth complexes to longer wavelengths so that the complexes can be excited not only by ultraviolet radiation but also by visible light of wavelengths up to 420 nm. Red photoluminescence is observed for the europium(III) complexes and near-infrared photoluminescence for the neodymium(III) and ytterbium(III) complexes. The presence of the ferrocene groups makes the rare-earth complexes hydrophobic and well-soluble in apolar organic solvents.

Visible-light-sensitized near-infrared luminescence from rare-earth complexes of the 9-hydroxyphenalen-1-one ligand

The unique absorption properties of the 9-hydroxyphenalen-1-one (HPHN) ligand have been exploited to obtain visible-light-sensitizable rare-earth complexes in 1: 3 and 1: 4 metal-to-ligand ratios. In both stoichiometries (1:3,tris,Ln(PHN)3;1:4, tetrakis, A[ Ln( PHN)(4)], with Ln being a trivalent rare-earth ion and A being a monovalent cation), the complexes of Nd(III),Er( III), and Yb(III) show typical near-infrared luminescence upon excitation with visible light with wavelengths up to 475 nm. The X-ray crystal structures of the tris complexes show solvent coordination to the central rare-earth ion, whereas in the tetrakis complexes, the four PHN-ligands form a protective shield around the central ion, preventing small solvent molecules from coordinating to the rare-earth ion, at least in the solid state.

Design, synthesis and photodynamic antimicrobial activity of ruthenium trischelate diimine complexes

In this study, we describe, for the first time, the synthesis and photophysical and microbiological investigation of ruthenium trischelate diimine complexes designed so as to possess properties specifically suited for use in Photodynamic antimicrobial chemotherapy (PACT). Of the three compounds investigated, one ([Ru(dmob)(3)]Cl-2) has demonstrated considerable promise as a photosensitiser for use in PACT. As a result, this compound is now the subject of comprehensive chemical, toxicological and formulation studies.

New ruthenium(II) complexes of functionalized monoanionic aryldiamine N,C,N'-terdentate ligands: Syntheses of [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl+(-); X-ray structure of a dimeric organolithium compound,[Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2)

The new anionic functionalized aryldiamine ligands [2,6-(Me(2)NCH(2))(2)-4-R-C6H2](-) (R = Me(3)SiC=C, C6H5, Me(3)Si), formally derived from [2,6-(Me(2)NCH(2))(2)C6H3](-), have been prepared as their lithium compounds. The compound [Li{2,6-(Me(2)NCH(2))(2)-4-Ph-C6H2}](2) crystallizes in the monoclinic space group C2/c (no. 15) with a = 13.1225(5), b = 13.5844(7), c = 15.9859(12) Angstrom, beta = 105.329(5)degrees, V = 3264.0(3)Angstrom(3), Z = 4. The structure refinement converged to R(1) = 0.0374 for 2037 observed reflections [F-o>4 sigma(F-o)] and wR(2) = 0.0922 for 2560 unique data. The organolithium compounds have been used in transmetalation reactions to give the corresponding functionalized organoruthenium(II) complexes [Ru-II{2,6-(Me(2)NCH(2))(2)-4-R-C6H2}(terpy)]Cl-+(-) (terpy = 2,2';6',2 ''-terpyridine). The Ru-II species with R = HC = C has also been synthesized.

Versatile N,C,N coordination behavior of a monoanionic aryldiamine ligand in ruthenium(II) complexes: Syntheses and crystal structures of [Ru-II(C6H3(CH(2)NMe(2))(2)-2,6)X(L)] (L equals norbornadiene, X=Cl, SO3CF3; L=PPh(3), X=I) and [Ru-II{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6:2''-terpyridine)]Cl

The monoanionic ligand [C6H3(CH(2)NMe(2))(2)-2,6](-), a potentially terdentate N,C,N bonding system, has been employed to synthesize a series of new ruthenium(II) complexes [Ru{C6H3(CH(2)NMe(2))(2)-2,6}X(L)] (L = PPh(3) X = Cl (2a), I (2b); L = norbornadiene (nbd), X = Cl (4), eta(1)-OSO2CF3 (5)) and [Ru{C6H3(CH(2)NMe(2))(2)-2,6}(2,2':6',2 ''-terpyridine)]Cl (3). X-ray crystal structures of 2b and 3-5 have been determined, in which the N,C,N coordination geometry with respect to the metal center is found to differ considerably. In each complex the aryldiamine ligand is terdentate, eta(3)-N,C,N-bonded as a six electron donor system. However, depending on the other ligands in the Ru(II) coordination sphere, this ligand demonstrates considerable flexibility in adopting coordination geometries which range from meridional in 3 through pseudomeridional in 2b to pseudofacial in 4 and 5. In the structures of 4 and 5 significant distortions of the aryl ring, involving bending of the six-membered ring into a boatlike conformation, are found. The different combinations of the N,C,N ligand with sets of other ligands lead to a range of metal geometries, i.e. square pyramidal in 2b, octahedral in 3, and bicapped tetrahedral in 4 and 5.

Long-range electronic coupling in bis(cyclometalated) ruthenium complexes

Symmetrical and unsymmetrical ligands containing terpyridyl coordinating units (N, N, N) or a cyclometalating equivalent (N, C, N), connected back-to-back either directly or via a p-terphenylene or 1,3-phenylene spacer, have been used to construct new diruthenium complexes. These compounds incorporate various terdentate chelates as capping ligands, to allow a double control of the electronic properties of each subcomplex and of the ensemble: via the terminal ligand or through the bridging fragment. Electronic coupling was studied from the intervalence transitions observed in several bimetallic ruthenium complexes of the bis-(cyclometalated) type differing by the substitution of a nitrogen atom by carbon in the terminal terpyridyl unit. The largest metal-metal interaction was found in complexes for which the terminal complexing unit is of the 1,3-di-2-pyridylbenzene type, i.e., with the carbon atom located on the metal-metal C-2 axis of the molecule. Investigations of the mechanism of interaction by extended Huckel calculations showed that the replacement of nitrogen by carbon raises the filled ligand levels, increasing the mixing with ligand orbitals and thus the metal-metal coupling. Finally, the intervalence transition was still observed for a bridging ligand containing three phenylene units as spacers, corresponding to a 24-Angstrom metal-metal distance.