Measurements of negative ion densities by absorption spectroscopy

A novel diagnostic technique for the measurement of negative ions is presented. The absorption of a cw-laser beam with a wavelength close to the maximum of the photodetachment cross section is measured. The laser beam undergoes multiple reflections through the discharge volume using a multipass cell there a Herriott arrangement). Proof-of-principle measurements of negative hydrogen ions in a hybrid volume source are presented. The measured H- density is in agreement with results of conventional, Langmuir probe-based photodetachment measurements. (C) 1998 American Institute of Physics. [S0003-6951(98)02119-6].

OPTICAL-ABSORPTION SPECTROSCOPY STUDY OF THE ROLE OF PLASMA CHEMISTRY IN YBA2CU3O7 PULSED LASER DEPOSITION

Time-resolved optical absorption spectroscopy techniques were used to study Ba, metastable Ba+, and YO absorptions in the laser-produced plasma plume from a YBa2Cu3O7 target. Results obtained indicate an initial explosive removal of material from the target sur-face followed by a subsequent evaporation process. Some YO is ejected from the target in molecular form, particularly at laser fluence

Mercury capture on a supported chlorocuprate(II) ionic liquid adsorbent studied using operando synchrotron X-ray absorption spectroscopy

Mercury scrubbing from gas streams using a supported 1-butyl-3-methylimidazolium chlorocuprate(II) ionic liquid ([C4mim]2[Cu2Cl6]) has been studied using operando EXAFS. Initial oxidative capture as [HgCl3]– anions was confirmed, this was then followed by the unanticipated generation of mercury(I) chloride through comproportionation with additional mercury from the gas stream. Combining these two mechanisms leads to net one electron oxidative extraction of mercury from the gas with increased potential capacity and efficiency for supported ionic liquid mercury scrubbers.

Species distribution and coordination of uranyl chloro complexes in acetonitrile

The complex formation of the uranyl ion, UO22+, with chloride ions in acetonitrile has been investigated by factor analysis of UV-vis absorption and U L-3 edge EXAFS (extended X-ray absorption fine structure) spectra. As a function of increasing [Cl-]/[UO22+] ratio, the five monomeric species [UO2(H2O)(5)](2+), [UO2Cl(H2O)(2)(MeCN)(2)](+), [UO2Cl2(H2O)(MeCN)(2)], [UO2Cl3(MeCN)(2)](-), and [UO2Cl4](2-) have been observed. The distances determined in the first coordination sphere are: U-O-ax = 1.77 angstrom, U-O-H2O = 2.43 angstrom, U-N-MeCN = 2.53 angstrom, and U-Cl = 2.68 angstrom. A crystalline material has been obtained from the intermediate solution with the [Cl-]/[UO22+] ratio of similar to 2, where [UO2Cl2(H2O)(MeCN)(2)] is the dominating species. The crystal structure analysis of this material revealed a tetrameric complex, [(UO2)(4)(mu(2)-Cl)(4)(mu(3)-O)(2)(H2O)(2)(CH3CN)(4)]center dot(CH3CN). The crystal data are: monoclinic, space group P2(1)/n, a 10.6388(5) angstrom, b = 14.8441(5) angstrom, c = 10.8521(5) angstrom, beta = 109.164(5)degrees, and Z = 2. The U(VI) coordination of the solution species [UO2Cl2(H2O)(MeCN)(2)] changes during the crystallization by replacing one MeCN molecule with a bridging mu(3)-O atom in the tetramer.

Simple method for the rapid simultaneous screening of photocatalytic activity over multiple positions of self-cleaning films

An intelligent ink, previously shown to be capable of rapidly assessing photocatalytic activity, was simply applied via a felt-pen onto a commercially available piece of Activ (TM) self-cleaning glass. The ink, comprising of redox dye resazurin and the sacrificial electron donor glycerol within an aqueous hydroxy ethyl cellulose (HEC) polymer media, was photocatalytically degraded in a two-step process. The key initial stage was the photo-reductive conversion of resazurin to resorufin, whereby a colour change from blue to pink occurred. The latter stage was the subsequent photo-reduction of the resorufin, where a slower change from pink to colourless was seen. Red and green components of red-green-blue colour extracted from flat-bed scanner digital images of resazurin ink coated photocatalytic films at intervals during the photocatalysis reaction were inversely proportional to the changes seen via UV-visible absorption spectroscopy and indicative of reaction kinetics. A 3 x 3 grid of intelligent ink was drawn onto a piece of Activ (TM) and a glass blank. The photocatalysis reaction was monitored solely by flat-bed digital scanning. Red-green-blue values of respective positions on the grid were extracted using a custom-built program entitled RGB Extractor (c). The program was capable of extracting a number of 5 x 5 pixel averages of red-green-blue components simultaneously. Allocation of merely three coordinates allowed for the automatic generation of a grid, with scroll-bars controlling the number of positions to be extracted on the grid formed. No significant change in red and green components for any position on the glass blank was observed; however, the Activ (TM) film displayed a homogenous photo-reduction of the dye, reaching maxima in red and minima in green components in 23 +/- 3 and 14 +/- 2 min, respectively. A compositionally graded N-doped titania film synthesised in house via a combinatorial APCVD reaction was also photocatalytically tested by this method where 247 positions on a 13 x 19 grid were simultaneously analysed. The dramatic variation in photocatalysis observed was rapidly quantified for all positions (2-3 hours) allowing for correlations to be made between thicknesses and N : Ti% compositions attained from Swanepoel and WDX analysis, respectively. N incorporation within this system was found to be detrimental to film activity for the photocatalysis reaction of intelligent ink under 365 nm light.

Signal enhancement of surface plasmon resonance immunoassay using enzyme precipitation-functionalized gold nanoparticles: A femto molar level measurement of anti-glutamic acid decarboxylase antibody

Colloidal gold nanoparticles (AuNPs) and precipitation of an insoluble product formed by HRP-biocatalyzed oxidation of 3,3'-diaminobenzidine (DAB) in the presence of H2O2 were used to enhance the signal obtained from the surface plasmon resonance (SPR) biosensor. The AuNPs were synthesized and functionalized with HS-OEG(3)-COOH by self assembling technique. Thereafter, the HS-OEG3-COOH functionalized nanoparticles were covalently conjugated with horseradish peroxidase (HRP) and anti IgG antibody to form an enzyme-immunogold complex. Characterizations were performed by several methods: UV-vis absorption, DLS, HR-TEM and Fr-IR. The Au-anti IgG-HRP complex has been applied in enhancement of SPR immunoassay using a sensor chip constructed by 1:9 molar ratio of HS-OEG(6)-COOH and HS-OEG(3)-OH for detection of anti-GAD antibody. As a result, AuNPs showed their enhancement as being consistent with other previous studies while the enzyme precipitation using DAB substrate was applied for the first time and greatly amplified the SPR detection. The limit of detection was found as low as 0.03 ng/ml of anti-GAD antibody (or 200 fM) which is much higher than that of previous reports. This study indicates another way to enhance SPR measurement, and it is generally applicable to other SPR-based immunoassays.

Effects of Gold Nanoparticle and Enzyme Precipitation on Enhancement of Surface Plasmon Resonance Immunoassay: A Super Sensitive Measurement of Anti- Glutamic Acid Decarboxylase Antibody

Introduction: In this study, colloidal gold nanoparticle and precipitation of an insoluble product formed by HRP-biocatalyzed oxidation of 3,3'-diaminobenzidine (DAB) in the presence of H2O2 were used to enhance the signal obtained from the surface plasmon resonance biosensor.

Methods: The colloidal gold nanoparticle was synthesized as described by Turkevitch et al., and their surface was firstly functionalized with HS(CH2)11(OCH2CH2)3COOH (OEG3¬-COOH) by self assembling technique. Thereafter, those OEG3-COOH functionalized nanoparticles were covalently conjugated with horseradish peroxidase (HRP) and anti-IgG antibody (specific to the Fc portion of all human IgG subclasses) to form an enzyme-immunogold complex. Characterization was performed by several methods: UV-Vis absorption, dynamic light scattering (DLS), transmission electron microscopy (TEM) and FTIR. The as-prepared enzyme-immunogold complex has been applied in enhancement of SPR immunoassay. A sensor chip used in the experiment was constructed by using 1:10 molar ratio of HS(CH2)11(OCH2CH2)6COOH and HS(CH2)11(OCH2CH2)3OH. The capture protein, GAD65 (autoantigen) which is recognized by anti-GAD antibody (autoantibody) in the sera of insulin-dependent diabetes mellitus patients, was immobilized onto the 1:10 surface via biotin-streptavidin interaction.

Results and conclusions: In the research, we reported the influences of gold nanoparticle and enzyme precipitation on the enhancement of SPR signal. Gold nanoparticle showed its enhancement as being consistent with other previous studies, while the enzyme precipitation using DAB substrate was applied for the first time and greatly amplified the SPR detection. As the results, anti-GAD antibody could be detected at pg/ml level which is far higher than that of commercial ELISA detection kit. This study indicates another way to enhance SPR measurement, and it is generally applicable to other SPR-based immunoassays.

Resonance Raman and lifetime studies on regioselectively deuteriated ruthenium (II) polypyridyl complexes

Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.

Coordination environment of [UO2Br4](2-) in ionic liquids and crystal structure of [Bmim](2)[UO2Br4]

The complex formed by the reaction of the uranyl ion, UO22+, with bromide ions in the ionic liquids 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide ([Bmiml[Tf2N]) and methyl-tributylammonium bis(trifluoromethylsulfonyl)imide ([MeBu3N][Tf2N]) has been investigated by UV-Vis and U L-III-edge EXAFS spectroscopy and compared to the crystal structure of [Bmim](2)[UO2Br4]. The solid state reveals a classical tetragonal bipyramid geometry for [UO2Br4](2-) with hydrogen bonds between the Bmim(+) and the coordinated bromides. The UV-Vis spectroscopy reveals the quantitative formation of [UO2Br4](2-) when a stoichiometric amount of bromide ions is added to UO2(CF3SO3)(2) in both Tf2N-based ionic liquids. The absorption spectrum also suggests a D-4h symmetry for [UO2Br4](2-) in ionic liquids, as previously observed for the [UO2Cl4](2-) congener. EXAFS analysis supports this conclusion and demonstrates that the [UO2Br4](2-) coordination polyhedron is maintained in the ionic liquids without any coordinating solvent or water molecules. The mean U-O and U-Br distances in the solutions, determined by EXAFS, are, respectively, 1.766(2) and 2.821(2)angstrom in [Bmim][Tf2N], and, respectively, 1.768(2) and 2.827(2) angstrom, in [MeBu3N][Tf2N]. Similar results are obtained in both ionic liquids indicating no significant influence of the ionic liquid cation either on the complexation reaction or on the structure of the uranyl species. (C) 2009 Elsevier Ltd. All rights reserved.

Mandelohydroxamic acid as ligand for copper(II) 15-metallacrown-5 lanthanide(III) and copper(II) 15-metallacrown-5 uranyl complexes

The formation of pentanuclear copper(ii) complexes with the mandelohydroxamic ligand was studied in solution by electrospray ionization mass spectrometry (ESI-MS), absorption spectrophotometry, circular dichroism and H-1 NMR spectroscopy. The presence of lanthanide(iii) or uranyl ions is essential for the self-assembly of the 15-metallacrown-5 compounds. The negative mode ESI-MS spectra of solutions containing copper(II), mandelohydroxamic acid and lanthanide(iii) ions (Ln = La, Ce, Nd, Eu, Gd, Dy, Er, Tm, Lu, Y) or uranyl in the ratio 5:5:1 showed only the peaks that could be unambiguously assigned to the following intact molecular ions: {Ln(NO3)(2)[15-MCuIIN(MHA)-5](2-)}(-) and {Ln(NO3)[15-MCCuIIN(MHA)-5](3-)}(-), where MHA represents doubly deprotonated mandelohydroxamic acid. The NMR spectra of the pentanuclear species revealed only one set of peaks indicating a fivefold symmetry of the complex. The pentanuclear complexes synthesized with the enantiomerically pure R- or S-forms of mandelohydroxamic acid ligand, showed circular dichroism spectra which were mirror images of each other. The pentanuclear complex made from the racemic form of the ligand showed no signals in the CD spectrum. The UV/ Vis titration experiments revealed that the order in which the metal salts are added to the solution of the mandelohydroxamic acid ligand is crucial for the formation of metallacrown complexes. The addition of copper(ii) to the solutions containing mandelohydroxamic acid and neodymium(iii) in a 5:1 ratio lead to the formation of a pentanuclear complex in solution. In contrary, titration of lanthanide(iii) salt to the solution containing copper(ii) and mandelohydroxamic acid did not show any evidence for the formation of pentanuclear species. ((c) Wiley-VCH Verlag GmbH & Co. KGaA, 69451 Weinheim, Germany, 2006)

Ruthenium(II) bis(terpyridine) electron transfer complexes with alkynyl-ferrocenyl bridges: synthesis, structures, and electrochemical and spectroscopic studies

Two novel alkynyl-bridged symmetric bis-tridentate ligands 1,2-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]-ferrocenyl)ethyne (3a; tpy-Fc-C C-Fc-tpy; Fc = ferrocenyl; tpy = terpyridyl) and 1,4-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]ferrocenyl)-1,3-butadiyne (3b; tpy-Fc-C C-C C-Fc-tpy) and their Ru2+ complexes 6a and 6b have been synthesized and characterized by cyclic voltammetry, UV-vis and luminescence spectroscopy, and in the case of 3b by single-crystal X-ray diffraction. Cyclic voltammograms of both compounds, 3a and 3b, display two severely overlapping ferrocene-based oxidative peaks with only one reductive peak. The redox behavior of 6a and 6b is dominated by the Ru2+/Ru3+ redox couple (E-1/2 from 1.33 to 1.34 V), the Fe2+/Fe3+ redox couples (E-1/2 from 0.46 to 0.80 V), and the tpy/tpy(-)/tpy(2-)redox couples (E-1/2 from -1.19 to -1.48 V). The UV-vis spectra of 6a and 6b show absorption bands assigned to the (1)[(d(pi)(Fe))(6)] -> (1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT transition at similar to 555 nm. Complexes 6a and 6b are luminescent in H2O-CH3CN (4 : 1, v/v) solution at room temperature, and 6b exhibits the strongest luminescence intensity (lambda(em)(max): 710 nm, Phi(em): 2.28 x 10(-4), tau: 358 ns) relative to analogous ferrocene-based bis(terpyridine) Ru(II) complexes reported so far.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Surface alloying and mixing at the Mn/Fe(001) interface: Real-time photoelectron spectroscopy and modified embedded atom simulations

Structural and magnetic properties of thin Mn films on the Fe(001) surface have been investigated by a combination of photoelectron spectroscopy and computer simulation in the temperature range 300 Kless than or equal toTless than or equal to750 K. Room-temperature as deposited Mn overlayers are found to be ferromagnetic up to 2.5-monolayer (ML) coverage, with a magnetic moment parallel to that of the iron substrate. The Mn atomic moment decreases with increasing coverage, and thicker samples (4-ML and 4.5-ML coverage) are antiferromagnetic. Photoemission measurements performed while the system temperature is rising at constant rate (dT/dtsimilar to0.5 K/s) detect the first signs of Mn-Fe interdiffusion at T=450 K, and reveal a broad temperature range (610 Kless than or equal toTless than or equal to680 K) in which the interface appears to be stable. Interdiffusion resumes at Tgreater than or equal to680 K. Molecular dynamics and Monte Carlo simulations allow us to attribute the stability plateau at 610 Kless than or equal toTless than or equal to680 K to the formation of a single-layer MnFe surface alloy with a 2x2 unit cell and a checkerboard distribution of Mn and Fe atoms. X-ray-absorption spectroscopy and analysis of the dichroic signal show that the alloy has a ferromagnetic spin structure, collinear with that of the substrate. The magnetic moments of Mn and Fe atoms in the alloy are estimated to be 0.8mu(B) and 1.1mu(B), respectively.