150 resultados para Sally Morgan
Resumo:
The right to request flexible working has been introduced into the UK employment laws against a background of post-fordist work practices, which already allow for employer rather than employee flexibility. This paper posits the idea that for the individual employee to benefit from these new rights what is required is the situation of dialogues within the workplace that take place in an ethical frame that recognises the employee as an individual.
Resumo:
This article compares, in the light of the House of Lords’ decision in R v Smith (Morgan James), the English and Irish approaches to the objective test in provocation. Though the law on this point has developed in radically different directions as between England and Ireland, both jurisdictions demonstrate a profound dissatisfaction with the objective test in its traditional formulation combined with a reluctance to dispense with it altogether. It is suggested that Lord Hoffmann’s approach in Morgan Smith, by drawing out the essentially normative function of the objective test, provides a useful way forward for the law on both sides of the Irish Sea.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.