MarA-mediated transcriptional repression of the rob promoter

The Escherichia coli transcriptional regulator MarA affects functions that include antibiotic resistance, persistence, and survival. MarA functions as an activator or repressor of transcription utilizing similar degenerate DNA sequences (marboxes) with three different binding site configurations with respect to the RNA polymerase-binding sites. We demonstrate that MarA down-regulates rob transcripts both in vivo and in vitro via a MarA-binding site within the rob promoter that is positioned between the -10 and -35 hexamers. As for the hdeA and purA promoters, which are repressed by MarA, the rob marbox is also in the "backward" orientation. Protein-DNA interactions show that SoxS and Rob, like MarA, bind the same marbox in the rob promoter. Electrophoretic mobility shift analyses with a MarA-specific antibody demonstrate that MarA and RNA polymerase form a ternary complex with the rob promoter DNA. Transcription experiments in vitro and potassium permanganate footprinting analysis show that MarA affects the RNA polymerase-mediated closed to open complex formation at the rob promoter.

Chiton phylogeny (Mollusca Polyplacophora) and the placement of the enigmatic species Choriplax grayi (H. Adams & Angas)

Shallow marine chitons (Mollusca:Polyplacophora:Chitonida) are widespread and well described from established morphoanatomical characters, yet key aspects of polyplacophoran phylogeny have remained unresolved. Several species, including Hemiarthrum setulosum Carpenter in Dall, 1876, and especially the rare and enigmatic Choriplax grayi (Adams & Angas, 1864), defy systematic placement. Choriplax is known from only a handful of specimens and its morphology is a mosaic of key taxonomic features from two different clades. Here, new molecular evidence provides robust support for its correct association with a third different clade: Choriplax is placed in the superfamily Mopalioidea. Hemiarthrum is included in Cryptoplacoidea, as predicted from morphological evidence. Our multigene analysis of standard nuclear and mitochondrial markers demonstrates that the topology of the order Chitonida is divided into four clades, which have also been recovered in previous studies: Mopalioidea is sister to Cryptoplacoidea, forming a clade Acanthochitonina. The family Callochitonidae is sister to Acanthochitonina. Chitonoidea is resolved as the earliest diverging group within Chitonida. Consideration of this unexpected result for Choriplax and our well-supported phylogeny has revealed differing patterns of shell reduction separating the two superfamilies within Acanthochitonina. As in many molluscs, shell reduction as well as the de novo development of key shell features has occurred using different mechanisms, in multiple lineages of chitons.

Accuracy of LightCycler SeptiFast for the detection and identification of pathogens in the blood of patients with suspected sepsis: a systematic review and meta-analysis

Purpose: There is an urgent need to develop diagnostic tests to improve the detection of pathogens causing life-threatening infection (sepsis). SeptiFast is a CE-marked multi-pathogen real-time PCR system capable of detecting DNA sequences of bacteria and fungi present in blood samples within a few hours. We report here a systematic review and meta-analysis of diagnostic accuracy studies of SeptiFast in the setting of suspected sepsis.

Methods: A comprehensive search strategy was developed to identify studies that compared SeptiFast with blood culture in suspected sepsis. Methodological quality was assessed using QUADAS. Heterogeneity of studies was investigated using a coupled forest plot of sensitivity and specificity and a scatter plot in receiver operator characteristic space. Bivariate model method was used to estimate summary sensitivity and specificity.

Results: From 41 phase III diagnostic accuracy studies, summary sensitivity and specificity for SeptiFast compared with blood culture were 0.68 (95 % CI 0.63–0.73) and 0.86 (95 % CI 0.84–0.89) respectively. Study quality was judged to be variable with important deficiencies overall in design and reporting that could impact on derived diagnostic accuracy metrics.

Conclusions: SeptiFast appears to have higher specificity than sensitivity, but deficiencies in study quality are likely to render this body of work unreliable. Based on the evidence presented here, it remains difficult to make firm recommendations about the likely clinical utility of SeptiFast in the setting of suspected sepsis.

Rapid detection of health-care-associated bloodstream infection in critical care using multipathogen real-time polymerase chain reaction technology: a diagnostic accuracy study and systematic review

Background: There is growing interest in the potential utility of real-time polymerase chain reaction (PCR) in diagnosing bloodstream infection by detecting pathogen deoxyribonucleic acid (DNA) in blood samples within a few hours. SeptiFast (Roche Diagnostics GmBH, Mannheim, Germany) is a multipathogen probe-based system targeting ribosomal DNA sequences of bacteria and fungi. It detects and identifies the commonest pathogens causing bloodstream infection. As background to this study, we report a systematic review of Phase III diagnostic accuracy studies of SeptiFast, which reveals uncertainty about its likely clinical utility based on widespread evidence of deficiencies in study design and reporting with a high risk of bias. 

Objective: Determine the accuracy of SeptiFast real-time PCR for the detection of health-care-associated bloodstream infection, against standard microbiological culture. 

Design: Prospective multicentre Phase III clinical diagnostic accuracy study using the standards for the reporting of diagnostic accuracy studies criteria. 

Setting: Critical care departments within NHS hospitals in the north-west of England. 

Participants: Adult patients requiring blood culture (BC) when developing new signs of systemic inflammation. 

Main outcome measures: SeptiFast real-time PCR results at species/genus level compared with microbiological culture in association with independent adjudication of infection. Metrics of diagnostic accuracy were derived including sensitivity, specificity, likelihood ratios and predictive values, with their 95% confidence intervals (CIs). Latent class analysis was used to explore the diagnostic performance of culture as a reference standard. 

Results: Of 1006 new patient episodes of systemic inflammation in 853 patients, 922 (92%) met the inclusion criteria and provided sufficient information for analysis. Index test assay failure occurred on 69 (7%) occasions. Adult patients had been exposed to a median of 8 days (interquartile range 4–16 days) of hospital care, had high levels of organ support activities and recent antibiotic exposure. SeptiFast real-time PCR, when compared with culture-proven bloodstream infection at species/genus level, had better specificity (85.8%, 95% CI 83.3% to 88.1%) than sensitivity (50%, 95% CI 39.1% to 60.8%). When compared with pooled diagnostic metrics derived from our systematic review, our clinical study revealed lower test accuracy of SeptiFast real-time PCR, mainly as a result of low diagnostic sensitivity. There was a low prevalence of BC-proven pathogens in these patients (9.2%, 95% CI 7.4% to 11.2%) such that the post-test probabilities of both a positive (26.3%, 95% CI 19.8% to 33.7%) and a negative SeptiFast test (5.6%, 95% CI 4.1% to 7.4%) indicate the potential limitations of this technology in the diagnosis of bloodstream infection. However, latent class analysis indicates that BC has a low sensitivity, questioning its relevance as a reference test in this setting. Using this analysis approach, the sensitivity of the SeptiFast test was low but also appeared significantly better than BC. Blood samples identified as positive by either culture or SeptiFast real-time PCR were associated with a high probability (> 95%) of infection, indicating higher diagnostic rule-in utility than was apparent using conventional analyses of diagnostic accuracy. 

Conclusion: SeptiFast real-time PCR on blood samples may have rapid rule-in utility for the diagnosis of health-care-associated bloodstream infection but the lack of sensitivity is a significant limiting factor. Innovations aimed at improved diagnostic sensitivity of real-time PCR in this setting are urgently required. Future work recommendations include technology developments to improve the efficiency of pathogen DNA extraction and the capacity to detect a much broader range of pathogens and drug resistance genes and the application of new statistical approaches able to more reliably assess test performance in situation where the reference standard (e.g. blood culture in the setting of high antimicrobial use) is prone to error.

New insights into sequence variation in the IGS region of 21 cyathostomin species and the implication for molecular identification

Cyathostomins comprise a group of 50 species of parasitic nematodes that infect equids. Ribosomal DNA sequences, in particular the intergenic spacer (IGS) region, have been utilized via several methodologies to identify pre-parasitic stages of the commonest species that affect horses. These methods rely on the availability of accurate sequence information for each species, as well as detailed knowledge of the levels of intra- and inter-specific variation. Here, the IGS DNA region was amplified and sequenced from 10 cyathostomin species for which sequence was not previously available. Also, additional IGS DNA sequences were generated from individual worms of 8 species already studied. Comparative analysis of these sequences revealed a greater range of intra-specific variation than previously reported (up to 23%); whilst the level of inter-specific variation (3-62%) was similar to that identified in earlier studies. The reverse line blot (RLB) method has been used to exploit the cyathostomin IGS DNA region for species identification. Here, we report validation of novel and existing DNA probes for identification of cyathostomins using this method and highlight their application in differentiating life-cycle stages such as third-stage larvae that cannot be identified to species by morphological means.

The molecular basis of galactosemia - Past, present and future

Galactosemia, an inborn error of galactose metabolism, was first described in the 1900s by von Ruess. The subsequent 100years has seen considerable progress in understanding the underlying genetics and biochemistry of this condition. Initial studies concentrated on increasing the understanding of the clinical manifestations of the disease. However, Leloir's discovery of the pathway of galactose catabolism in the 1940s and 1950s enabled other scientists, notably Kalckar, to link the disease to a specific enzymatic step in the pathway. Kalckar's work established that defects in galactose 1-phosphate uridylyltransferase (GALT) were responsible for the majority of cases of galactosemia. However, over the next three decades it became clear that there were two other forms of galactosemia: type II resulting from deficiencies in galactokinase (GALK1) and type III where the affected enzyme is UDP-galactose 4'-epimerase (GALE). From the 1970s, molecular biology approaches were applied to galactosemia. The chromosomal locations and DNA sequences of the three genes were determined. These studies enabled modern biochemical studies. Structures of the proteins have been determined and biochemical studies have shown that enzymatic impairment often results from misfolding and consequent protein instability. Cellular and model organism studies have demonstrated that reduced GALT or GALE activity results in increased oxidative stress. Thus, after a century of progress, it is possible to conceive of improved therapies including drugs to manipulate the pathway to reduce potentially toxic intermediates, antioxidants to reduce the oxidative stress of cells or use of "pharmacological chaperones" to stabilise the affected proteins.

Global identification of androgen response elements

Chromatin immunoprecipitation (ChIP) is an invaluable tool in the study of transcriptional regulation. ChIP methods require both a priori knowledge of the transcriptional regulators which are important for a given biological system and high-quality specific antibodies for these targets. The androgen receptor (AR) is known to play essential roles in male sexual development, in prostate cancer and in the function of many other AR-expressing cell types (e.g. neurons and myocytes). As a ligand-activated transcription factor the AR also represents an endogenous, inducible system to study transcriptional biology. Therefore, ChIP studies of the AR can make use of treatment contrast experiments to define its transcriptional targets. To date several studies have mapped AR binding sites using ChIP in combination with genome tiling microarrays (ChIP-chip) or direct sequencing (ChIP-seq), mainly in prostate cancer cell lines and with varying degrees of genomic coverage. These studies have provided new insights into the DNA sequences to which the AR can bind, identified AR cooperating transcription factors, mapped thousands of potential AR regulated genes and provided insights into the biological processes regulated by the AR. However, further ChIP studies will be required to fully characterise the dynamics of the AR-regulated transcriptional programme, to map the occupancy of different AR transcriptional complexes which result in different transcriptional output and to delineate the transcriptional networks downstream of the AR.

Chromatin immunoprecipitation (ChIP) methodology and readouts

The identification of direct nuclear hormone receptor gene targets provides clues to their contribution to both development and cancer progression. Until recently, the identification of such direct target genes has relied on a combination of expression analysis and in silico searches for consensus binding motifs in gene promoters. Consensus binding motifs for transcription factors are often defined using in vitro DNA binding strategies. Such in vitro strategies fail to account for the many factors that contribute significantly to target selection by transcription factors in cells beyond the recognition of these short consensus DNA sequences. These factors include DNA methylation, chromatin structure, posttranslational modifications of transcription factors, and the cooperative recruitment of transcription factor complexes. Chromatin immunoprecipitation (ChIP) provides a means of isolating transcription factor complexes in the context of endogenous chromatin, allowing the identification of direct transcription factor targets. ChIP can be combined with site-specific PCR for candidate binding sites or alternatively with cloning, genomic microarrays or more recently direct high throughput sequencing to identify novel genomic targets. The application of ChIP-based approaches has redefined consensus binding motifs for transcription factors and provided important insights into transcription factor biology.

Identification of Miscellaneous Peptides from the Skin Secretion of the European Edible Frog, Pelophylax kl. Esculentus

The chemical compounds synthesised and secreted from the dermal glands of amphibian have diverse bioactivities that play key roles in the hosts' innate immune system and in causing diverse pharmacological effects in predators that may ingest the defensive skin secretions. As new biotechnological methods have developed, increasing numbers of novel peptides with novel activities have been discovered from this source of natural compounds. In this study, a number of defensive skin secretion peptide sequences were obtained from the European edible frog, P. kl. esculentus, using a 'shotgun' cloning technique developed previously within our laboratory. Some of these sequences have been previously reported but had either obtained from other species or were isolated using different methods. Two new skin peptides are described here for the first time. Esculentin-2c and Brevinin-2Tbe belong to the Esculentin-2 and Brevinin-2 families, respectively, and both are very similar to their respective analogues but with a few amino acid differences. Further, [Asn-3, Lys-6, Phe-13] 3-14-bombesin isolated previously from the skin of the marsh frog, Rana ridibunda, was identified here in the skin of P. kl. esculentus. Studies such as this can provide a rapid elucidation of peptide and corresponding DNA sequences from unstudied species of frogs and can rapidly provide a basis for related scientific studies such as those involved in systematic or the evolution of a large diverse gene family and usage by biomedical researchers as a source of potential novel drug leads or pharmacological agents.

PCR amplification of short tandem repeat sequences allows serial studies of chimaerism/engraftment following BMT in rodents

Animal models of bone marrow transplantation (BMT) allow evaluation of new experimental treatment strategies. One potential strategy involves the treatment of donor marrow with ultra-violet B light to allow transplantation across histocompatibility boundaries without an increase in graft rejection or graft-versus-host disease. A major requirement for a new experimental protocol, particularly if it involves manipulation of the donor marrow, is that the manipulated marrow gives rise to long-term multilineage engraftment. DNA based methodologies are now routinely used by many centres to evaluate engraftment and degree of chimaerism post-BMT in humans. We report the adaptation of this methodology to the serial study of engraftment in rodents. Conditions have been defined which allow analysis of serial tail vein samples using PCR of short tandem repeat sequences (STR-PCR). These markers have been used to evaluate the contribution of ultraviolet B treated marrow to engraftment following BMT in rodents without compromising the health of the animals under study. Chimaerism data from sequential tail vein samples and bone marrow from selected sacrificed animals showed excellent correlation, thus confirming the validity of this approach in analysing haemopoietic tissue. Thus the use of this assay may facilitate experimental studies in animal BMT.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

DNA from pollen: principles and potential

This paper describes our recent extraction of ancient DNA (aDNA) from Holocene pollen and discusses the potential of the technique for elucidating timescales of evolutionary change. We show that plastid DNA is recoverable and usable from pollen grains of Scots pine Pinus sylvestris from 10 ka and 100 years ago. Comparison of the ancient sequences with modern sequences, obtained from an extant population, establish a first genetic link between modern and fossil samples of Scots pine, providing a genetic continuity through time. One common haplotype is present in each of the three periods investigated, suggesting that it persisted near the lake throughout the postglacial. The retrieval of aDNA from pollen has major implications for palaeoecology by allowing (i) investigation of population level dynamics in time and space, and (ii) tracing ancestry of populations and developing phylogenetic trees that include extinct as well as extant taxa. The method should work over the last glacial oscillation, thus giving access to ancestry of populations over a crucial period of time for the understanding of the relationship between speciation and climate change.

Specific and sensitive detection of Nosema bombi (Microsporidia : Nosematidae) in bumble bees (Bombus spp.; Hymenoptera : Apidae) by PCR of partial rRNA gene sequences

A polymerase chain reaction (PCR) based method was developed for the specific and sensitive diagnosis of the microsporidian parasite Nosema bombi in bumble bees (Bombus spp.). Four primer pairs, amplifying ribosomal RNA (rRNA) gene fragments, were tested on N. bombi and the related microsporidia Nosema apis and Nosema ceranae, both of which infect honey bees. Only primer pair Nbombi-SSU-Jf1/Jr1 could distinguish N. bombi (323 bp amplicon) from these other bee parasites. Primer pairs Nbombi-SSU-Jf1/Jr1 and ITS-f2/r2 were then tested for their sensitivity with N. bombi spore concentrations from 107 down to 10 spores diluted in 100 mu l of either (i) water or (ii) host bumble bee homogenate to simulate natural N. bombi infection (equivalent to the DNA from 10(6) spores down to 1 spore per PCR). Though the N. bombi-specific primer pair Nbombi-SSU-Jf1/Jr1 was relatively insensitive, as few as 10 spores per extract (equivalent to 1 spore per PCR) were detectable using the N. bombi-non-specific primer pair ITS-f2/r2, which amplifies a short fragment of similar to 120 bp. Testing 99 bumble bees for N. bombi infection by light microscopy versus PCR diagnosis with the highly sensitive primer pair ITS-f2/r2 showed the latter to b more accurate. PCR diagnosis of N. bombi using a combination of two primer pairs (Nbombi-SSU-Jf1/Jr1 and ITS-f2/r2) provides increased specificity, sensitivity, and detection of all developmental stages compared with light microscopy. (c) 2005 Elsevier Inc. All rights reserved.

The dichotomy in the DNA-binding behaviour of ruthenium(II) complexes bearing benzoxazole and benzothiazole groups

The substituted tris(bipyridine)ruthenium(II) complexes {[Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru(bpy)(2)(5,5'-bbob)](2+) [where bpy = 2,2'-bipyridine and bbob = bis(benzoxazol-2-yl)-2,2'-bipyridine] have been prepared and compared to the previously studied complex [Ru(bpy)(2)(4,4'-bbtb)](2+) [where bbtb = bis(benzothiazol-2-yl)-2,2'-bipyridine]. From the UV/VIS titration studies, Delta-[Ru(bpy)(2)(4,4'bbob)](2+) displays a stronger association than the Lambda-isomer with calf-thymus DNA (ct-DNA). For [Ru(bpy)(2)(5,5'-bbob)](2+), there appears to be minimal interaction with ct-DNA. The results of fluorescence titration studies suggest that [Ru(bpy)(2)(4,4'-bbob)](2+) gives an increase in emission intensity with increasing ct-DNA concentrations, with an enantiopreference for the A isomer, confirmed by membrane dialysis studies. The fluorescent intercalation displacement studies revealed that [Ru(bpy)(2)(4,4'-bbob)](2+) and [Ru.(bpy)(2)(5,5'bbob)](2+) display a preference for more open DNA structures such as bulge and hairpin sequences. While Delta-[Ru(bpy)(2)(4,4'-bbtb)](2+) has shown the most significant affinity for all the oligonucleotides sequences screened in previous studies, it is the A isomer of the comparable benzoxazole ruthenium(II) complex (Delta-[Ru(bpy)(2)(4,4'-bbob)](2+)) that preferentially binds to DNA.