52 resultados para Platinum(II) complex
Resumo:
Resonance Raman spectroscopy has been used to probe the structures of; tetrakis(1-methylpyridinium-4-yl)-porphinatoiron(III), FeIII (T4MPyP); tetrakis(1-methylpyridium-2-yl)porphinatoiron(III), FeIII (T2MPyP); tetrakis(4-sulphonatophkenyl)porphinatoir(III), FeIII(TSPP); and tetrakis(4-carboxylatophenyl)porphinatoiron(III), FeIII(TCPP), over a wide pH range. The anionic complexes FeIII (TSPP) and FeIII (TCPP) contain high-spin iron(III) at all pHs. Both these complexes exhibit marked spectral changes at ca. pH 6 which correspond to conversion from the diaquo species, in acid solution, to hydroxy- or mu-oxo dimer complexes. Both cationic complexes show similar diaquo to high-spin hydroxy, or mu-oxo dimer, transitions at ca. pH 6. However, at pH > 11.5 for FeIII (T4MPyP) and pH > 9 for FeIII (T2MPyP) a second equilibrium process is observed, leading to two new species. One of these is readily assigned as the low-spin iron(III) dihydroxy complex by analogy with spectra of the dicyano complex. The second species is assigned to the hydroxy iron(II) complex by comparison with photo-chemically generated FeII (T4MPyP) (OH). The formation of iron(II) species in alkaline solutions of FeIII (T4MPyP) and FeIII (T2MPyP) is entirely unexpected and the significance of the observation to previous investigations of the pH-dependent behaviour of these complexes is discussed.
Resumo:
Two porphyrins, platinum(II) octaethylporphyrin (Pt-OEP) and palladium(II) octaethylporphyrin (Pd-OEP), are incorporated into a wide variety of different encapsulating matricies and tested as oxygen sensors, The excited state lifetimes of the two porphyrins are quite different, 0.091 ms for Pt-OEP and 0.99 ms for Pd-OEP, and Pt-OEP-based oxygen sensors are found to be much less sensitive than Pd-OEP-based ones to quenching by oxygen, Two major response characteristics of an oxygen sensor are (i) its sensitivity toward oxygen and (ii) its response and recovery times when exposed to an alternating atmosphere of nitrogen and air. The response characteristics of a rang of Pt-OEP, and Pd-OEP-based oxygen sensors were determined using cellulose acetate butyrate (CAB), poly(methyl methacrylate) (PMMA), and PMMA/CAB polymer blends as the encapsulating media. Pt-OEP and Pd-OEP oxygen sensors have better response characteristics (i.e., more sensitive and lower response and recovery times) when CAB is used as the encapsulating medium rather than PMMA. For both Pt-OEP- and Pd-OEP-based oxygen sensors, in either polymer, increasing the level of tributyl phosphate plasticizer improves the response characteristics of the final oxygen-sensitive film. Pt-OEP in different unplasticized PMMA/CAB blended films produced a range of oxygen sensors in which the response characteristics improved with increasing level of CAB present.
Resumo:
CO oxidation on PtO2(110) has been studied using density functional theory calculations. Four possible reaction mechanisms were investigated and the most feasible one is the following: (i) the O at the bridge site of PtO2(110) reacts with CO on the coordinatively unsaturated site (CUS) with a negligible barrier; (ii) O-2 adsorbs on the bridge site and then interacts with CO on the CUS to form an OO-CO complex; (iii) the bond of O-OCO breaks to produce CO2 with a small barrier (0.01 eV). The CO oxidation mechanisms on metals and metal oxides are rationalized by a simple model: The O-surface bonding determines the reactivity on surfaces; it also determines whether the atomic or molecular mechanism is preferred. The reactivity on metal oxides is further found to be related to the 3rd ionization energy of the metal atom.
Resumo:
Type II DNA topoisomerases catalyse DNA double-strand cleavage, passage and re-ligation to effect topological changes. There is considerable interest in elucidating topoisomerase II roles, particularly as these proteins are targets for anti-cancer drugs. Here we uncover a role for topoisomerase IIa in RNA polymerase I-directed ribosomal RNA gene transcription, which drives cell growth and proliferation and is upregulated in cancer cells. Our data suggest that topoisomerase IIa is a component of the initiation-competent RNA polymerase Iß complex and interacts directly with RNA polymerase I-associated transcription factor RRN3, which targets the polymerase to promoter-bound SL1 in pre-initiation complex formation. In cells, activation of rDNA transcription is reduced by inhibition or depletion of topoisomerase II, and this is accompanied by reduced transient double-strand DNA cleavage in the rDNA-promoter region and reduced pre-initiation complex formation. We propose that topoisomerase IIa functions in RNA polymerase I transcription to produce topological changes at the rDNA promoter that facilitate efficient de novo pre-initiation complex formation.
Resumo:
Background: Our previous laboratory and clinical data suggested that one mechanism underlying the development of platinum resistance in ovarian cancer is the acquisition of DNA methylation. We therefore tested the hypothesis that the DNA hypomethylating agent 5-aza-2'-deoxycytodine (decitabine) can reverse resistance to carboplatin in women with relapsed ovarian cancer.
Methods: Patients progressing 6-12 months after previous platinum therapy were randomised to decitabine on day 1 and carboplatin (AUC 6) on day 8, every 28 days or carboplatin alone. The primary objective was response rate in patients with methylated hMLH1 tumour DNA in plasma.
Results: After a pre-defined interim analysis, the study closed due to lack of efficacy and poor treatment deliverability in 15 patients treated with the combination. Responses by GCIG criteria were 9 out of 14 vs 3 out of 15 and by RECIST were 6 out of 13 vs 1 out of 12 for carboplatin and carboplatin/decitabine, respectively. Grade 3/4 neutropenia was more common with the combination (60% vs 15.4%) as was G2/3 carboplatin hypersensitivity (47% vs 21%).
Conclusions: With this schedule, the addition of decitabine appears to reduce rather than increase the efficacy of carboplatin in partially platinum-sensitive ovarian cancer and is difficult to deliver. Patient-selection strategies, different schedules and other demethylating agents should be considered in future combination studies.
Resumo:
Evolution can increase the complexity of matter by self-organization into helical architectures, the best example being the DNA double helix. One common aspect, apparently shared by most of these architectures, is the presence of covalent bonds within the helix backbone. Here, we report the unprecedented crystal structures of a metal complex that self-organizes into a continuous double helical structure, assembled by non-covalent building blocks. Built up solely by weak stacking interactions, this alternating tread stairs-like double helical assembly mimics the DNA double helix structure. Starting from a racemic mixture in aqueous solution, the ruthenium(II) polypyridyl complex forms two polymorphic structures of a left-handed double helical assembly of only the Λ-enantiomer. The stacking of the helices is different in both polymorphs: a crossed woodpile structure versus a parallel columnar stacking.
Resumo:
Mitochondrial Complex II is a key mitochondrial enzyme connecting the tricarboxylic acid (TCA) cycle and the electron transport chain. Studies of complex II are clinically important since new roles for this enzyme have recently emerged in cell signalling, cancer biology, immune response and neurodegeneration. Oxaloacetate (OAA) is an intermediate of the TCA cycle and at the same time is an inhibitor of complex II with high affinity (Kd ~ 10− 8 M). Whether or not OAA inhibition of complex II is a physiologically relevant process is a significant, but still controversial topic. We found that complex II from mouse heart and brain tissue has similar affinity to OAA and that only a fraction of the enzyme in isolated mitochondrial membranes (30.2 ± 6.0% and 56.4 ± 5.6% in the heart and brain, respectively) is in the free, active form. Since OAA could bind to complex II during isolation, we established a novel approach to deplete OAA in the homogenates at the early stages of isolation. In heart, this treatment significantly increased the fraction of free enzyme, indicating that OAA binds to complex II during isolation. In brain the OAA-depleting system did not significantly change the amount of free enzyme, indicating that a large fraction of complex II is already in the OAA-bound inactive form. Furthermore, short-term ischemia resulted in a dramatic decline of OAA in tissues, but it did not change the amount of free complex II. Our data show that in brain OAA is an endogenous effector of complex II, potentially capable of modulating the activity of the enzyme.
Resumo:
Monomeric ruthenium(II) complexes [Ru(L)3]2+ containing unsymmetric bipyridine ligands [Where L = 5-methyl-2,2'-bipyridine (L1), 5-ethyl-2,2'-bipyridine (L2), 5-propyl-2,2'-bipyridine (L3), 5-(2-methylpropyl)-2,2'-bipyridine (L4), 5-(2,2-dimethylpropyl)-2,2'-bipyridine (L5) and 5-(carbomethoxy)-2,2'-bipyridine (L6)] have been studied and the meridional and facial isomers isolated by the use of cation-exchange column chromatography (SP Sephadex C-25) eluting with either sodium toluene-4-sulfonate or sodium hexanoate. The relative yield of the facial isomer was found to decrease with increasing steric bulk, preventing the isolation of fac-[Ru(L5)3]2+. The two isomeric forms were characterized by 1H NMR, with the complexes [Ru(L1-3)3]2+ demonstrating an unusually large coupling between the H6 and H4 protons. Crystals suitable for X-ray structural analysis of [Ru(L1)3]2+ were obtained as a mixture of the meridional and facial isomers, indicating that separation of this isomeric mixture could not be achieved by fractional crystallisation. The optical isomers of the complex [Ru(L3)3]2+ were chromatographically separated on SP Sephadex C-25 relying upon the inherent chirality of the support. It is apparent that chiral interactions can inhibit geometric isomer separation using this technique.
Resumo:
The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.
Resumo:
Two series of ruthenium(II) polypyridyl complexes [Ru(bipy)2(phpytr)]+ and [Ru(bipy)2(phpztr)]+ (where Hphpytr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyridine and Hphpztr = 2-(5-phenyl-1H-[1,2,4]triazol-3-yl)-pyrazine) are examined by electrochemistry, UV/Vis, emission, resonance Raman, transient resonance Raman and transient absorption spectroscopy, in order to obtain a more comprehensive understanding of their excited state electronic properties. The interpretation of the results obtained is facilitated by the availability of several isotopologues of each of the complexes examined. For the pyridine-1,2,4-triazolato based complex the lowest emissive excited state is exclusively bipy based, however, for the pyrazine based complexes excited state localisation on particular ligands shows considerable solvent and pH dependency.